
Results for "CA10"

Variant Events: 81

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
CA10     2-1522-003chr17:
TCintergenicDe novo--Yuen2017 G
CA10     2-1399-003chr17:
TCintergenicDe novo--Yuen2017 G
CA10     2-1715-003chr17:
GAAATACTAGintronicDe novo--Yuen2017 G
CA10     2-1155-003chr17:
TAintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     AU4223302chr17:
AGintergenicDe novo--Yuen2017 G
CA10     1-0569-003chr17:
CTintergenicDe novo--Yuen2017 G
CA10     1-0715-003chr17:
CGintergenicDe novo--Yuen2017 G
CA10     AU4067301chr17:
TCintergenicDe novo--Yuen2017 G
CA10     1-0329-004chr17:
ACintergenicDe novo--Yuen2017 G
CA10     AU3636302chr17:
TAintergenicDe novo--Yuen2017 G
CA10     200675699_1082034170chr17:
AGexonicDe novononsynonymous SNVNM_020178
14.91-Fu2022 E
CA10     5-0087-003chr17:
TGintergenicDe novo--Yuen2017 G
CA10     2-0306-003chr17:
TGintronicDe novo--Yuen2016 G
CA10     2-1529-003chr17:
ATAintergenicDe novo--Yuen2017 G
CA10     1-0338-003chr17:
GAintergenicDe novo--Yuen2017 G
CA10     DEASD_0100_001chr17:
GAexonicDe novosynonymous SNVNM_020178
--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CA10     7-0130-003chr17:
CCCATAATATTACAintergenicDe novo--Yuen2017 G
CA10     CC1132_201chr17:
GAexonicDe novononsynonymous SNVNM_020178
20.5-Fu2022 E
CA10     1-0526-003chr17:
TAACTCTintronicDe novo--Yuen2017 G
CA10     1-0045-004chr17:
GAintergenicDe novo--Yuen2017 G
CA10     AU051504chr17:
TCintronicDe novo--Yuen2017 G
CA10     1-0009-004chr17:
AGintergenicDe novo--Yuen2017 G
CA10     1-0045-004chr17:
CAintronicDe novo--Yuen2017 G
CA10     1-0925-003chr17:
GAintergenicDe novo--Yuen2017 G
CA10     1-1004-003chr17:
TCintronicDe novo--Yuen2017 G
CA10     2-1279-003chr17:
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CA10     2-1357-003chr17:
AGintergenicDe novo--Yuen2017 G
CA10     1-0871-003chr17:
TCintronicDe novo--Yuen2017 G
CA10     AU3937301chr17:
GAintronicDe novo--Yuen2017 G
CA10     1-0206-003chr17:
CGintergenicDe novo--Yuen2017 G
CA10     1-0863-003chr17:
AGintergenicDe novo--Yuen2017 G
CA10     2-1148-004chr17:
GAintergenicDe novo--Yuen2017 G
CA10     AU3888302chr17:
GAintergenicDe novo--Yuen2017 G
CA10     2-0116-005chr17:
GAintergenicDe novo--Yuen2017 G
CA10     1-0756-004chr17:
GGTCTACAGCCTAAGintronicDe novo--Yuen2017 G
CA10     2-0704-003chr17:
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     5-0018-003chr17:
ACintergenicDe novo--Yuen2017 G
CA10     2-0116-005chr17:
GAintergenicDe novo--Yuen2017 G
CA10     AU3874301chr17:
CAintergenicDe novo--Yuen2017 G
CA10     Chen2017:111chr17:
AGexonicDe novononsynonymous SNVNM_020178
14.91-Chen2017 E
CA10     AU3809302chr17:
GAintronicDe novo--Yuen2017 G
CA10     2-1242-003chr17:
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     7-0095-004chr17:
CCTTTTTTTTTGTTTTTTTGTintronicDe novo--Yuen2017 G
CA10     2-0129-004chr17:
AATintergenicDe novo--Yuen2017 G
CA10     A12chr17:
CTintergenicDe novo--Wu2018 G
CA10     2-1384-003chr17:
TCintergenicDe novo--Yuen2017 G
CA10     1-0045-003chr17:
GAintronicDe novo--Yuen2017 G
CA10     AU2458303chr17:
GAintergenicDe novo--Yuen2017 G
CA10     1-0572-003chr17:
CGintergenicDe novo--Yuen2017 G
CA10     2-1168-003chr17:
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
CA10     2-0210-005chr17:
GTintergenicDe novo--Yuen2017 G
CA10     2-0306-004chr17:
TGintronicDe novo--Yuen2017 G
CA10     AU3713302chr17:
GTTATTATTGTTATTintergenicDe novo--Yuen2017 G
CA10     7-0067-003chr17:
GTintronicDe novo--Yuen2017 G
CA10     AU4233301chr17:
TGintronicDe novo--Yuen2017 G
CA10     1-0173-004chr17:
GAintronicDe novo--Yuen2017 G
CA10     2-1620-004chr17:
CTintergenicDe novo--Yuen2017 G
CA10     2-1736-003chr17:
TTCTCTCTCTTTCTCTintergenicDe novo--Yuen2017 G
CA10     2-0318-004chr17:
AGintergenicDe novo--Yuen2017 G
CA10     3-0140-000chr17:
AGintronicDe novo--Yuen2017 G
CA10     1-0320-003chr17:
GAexonicDe novononsynonymous SNVNM_020178
20.5-Yuen2015 G
CA10     09C86110chr17:
TCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
CA10     AU4013301chr17:
GAintergenicDe novo--Yuen2017 G
CA10     1-0325-003chr17:
CAintronicDe novo--Yuen2017 G
CA10     1-0571-003chr17:
TCintergenicDe novo--Yuen2017 G
CA10     1-0336-003chr17:
GAintergenicDe novo--Yuen2017 G
CA10     2-0242-004chr17:
CCTintergenicDe novo--Yuen2017 G
CA10     2-1305-003chr17:
CGintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     AU3632301chr17:
TCintergenicDe novo--Yuen2017 G
CA10     2-1731-003chr17:
TCintergenicDe novo--Yuen2017 G
CA10     CC1132.201chr17:
GAexonicDe novononsynonymous SNVNM_020178
20.5-Satterstrom2020 E
CA10     AU079104chr17:
TCintergenicDe novo--Yuen2017 G
CA10     AU4153301chr17:
CTintergenicDe novo--Yuen2017 G
CA10     3-0447-000chr17:
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     A18chr17:
AGintergenicDe novo--Wu2018 G
CA10     2-0305-004chr17:
AGintergenicDe novo--Yuen2017 G
CA10     1-0405-003chr17:
ACAintergenicDe novo--Yuen2017 G
CA10     2-1427-003chr17:
GTintronicDe novo--Yuen2017 G
CA10     2-1617-003chr17:
GAintergenicDe novo--Yuen2017 G
CA10     AU060703chr17:
TCintergenicDe novo--Yuen2017 G
CA10     AU4032306chr17:
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView