or
or
Exact

Results for "ARHGAP18"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARHGAP18     AU3760301chr6:
130105689-130105689
AGintergenicDe novo--Yuen2017 G
ARHGAP18     11341.p1chr6:
129979061-129979061
CGintronicDe novo--Turner2016 G
ARHGAP18     2-1415-004chr6:
130125028-130125028
TCintergenicDe novo--Yuen2017 G
ARHGAP18     2-1511-003chr6:
130056457-130056457
TCintergenicDe novo--Yuen2017 G
ARHGAP18     AU3724301chr6:
130122067-130122067
CTintergenicDe novo--Yuen2017 G
ARHGAP18     AU3765303chr6:
130132301-130132301
TGintergenicDe novo--Yuen2017 G
ARHGAP18     1-0006-004chr6:
130102464-130102464
CCTATAAAintergenicDe novo--Yuen2017 G
ARHGAP18     11341.p1chr6:
129923797-129923797
TCintronicDe novo--Turner2016 G
ARHGAP18     AU4093301chr6:
129907822-129907822
TAintronicDe novo--Yuen2017 G
ARHGAP18     1-0323-004chr6:
129964950-129964950
TAintronicDe novo--Yuen2017 G
ARHGAP18     7-0127-003chr6:
130071726-130071751
CAGAACAGGCTCCTCCACTTGACACTCintergenicDe novo--Yuen2017 G
ARHGAP18     3-0442-000chr6:
129994586-129994586
GTintronicDe novo--Yuen2016 G
Yuen2017 G
ARHGAP18     1-0868-003chr6:
130051171-130051171
TGintergenicDe novo--Yuen2017 G
ARHGAP18     2-0127-004chr6:
129935298-129935298
AGintronicDe novo--Yuen2017 G
ARHGAP18     AU071203chr6:
130083946-130083946
ACintergenicDe novo--Yuen2017 G
ARHGAP18     JASD_Fam0216chr6:
129963090-129963090
GAexonicDe novostopgainNM_033515c.C187Tp.R63X23.48.24E-6Takata2018 E
ARHGAP18     3-0185-000chr6:
129923445-129923445
CTintronicDe novo--Yuen2017 G
ARHGAP18     2-0242-004chr6:
129996150-129996150
TCintronicDe novo--Yuen2017 G
ARHGAP18     1-0006-003chr6:
130102464-130102464
CCTATAAAintergenicDe novo--Yuen2017 G
ARHGAP18     2-0006-003chr6:
130018388-130018388
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More