or
or
Exact

Results for "CARD11"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CARD11     2-1235-004chr7:
3077346-3077346
GTintronicDe novo--Yuen2017 G
CARD11     1-0119-004chr7:
3128880-3128880
CTintergenicDe novo--Yuen2017 G
CARD11     11572.p1chr7:
2965364-2965364
GCintronicDe novo--Turner2016 G
CARD11     1-0385-003chr7:
2959801-2959801
GAintronicDe novo--Yuen2017 G
CARD11     14637.p1chr7:
2965364-2965364
GCintronicDe novo--Turner2016 G
CARD11     1-0458-004chr7:
3159958-3159958
TTCintergenicDe novo--Yuen2017 G
CARD11     2-0003-003chr7:
3159787-3159787
TTCATTACCATCATCTTCATCATCACCACCCTCTTCACintergenicDe novo--Yuen2017 G
CARD11     1-0025-006chr7:
3159958-3159958
TTCintergenicDe novo--Yuen2017 G
CARD11     AU3617302chr7:
2974046-2974046
TCintronicDe novo--Yuen2017 G
CARD11     Lim2017:12108chr7:
2951847-2951847
CTexonicDe novononsynonymous SNVNM_032415c.G3103Ap.E1035K19.89-Lim2017 E
CARD11     1-0261-003chr7:
3126077-3126077
CTintergenicDe novo--Yuen2017 G
CARD11     1-0377-003chr7:
3075398-3075398
CTintronicDe novo--Yuen2017 G
CARD11     Lim2017:5022chr7:
2984055-2984055
GCexonicDe novononsynonymous SNVNM_032415c.C475Gp.L159V16.96-Lim2017 E
CARD11     3-0431-000chr7:
3013169-3013169
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CARD11     2-1356-003chr7:
3019628-3019628
ACintronicDe novo--Yuen2016 G
Yuen2017 G
CARD11     12108chr7:
2951847-2951847
CTexonicDe novononsynonymous SNVNM_032415c.G3103Ap.E1035K19.89-Satterstrom2020 E
CARD11     AU012803chr7:
3168852-3168852
GAintergenicDe novo--Yuen2017 G
CARD11     AU021204chr7:
2953977-2953977
CTintronicDe novo--Yuen2017 G
CARD11     AU021204chr7:
3006262-3006262
CAintronicDe novo--Yuen2017 G
CARD11     11572.p1chr7:
2965360-2965360
AGintronicDe novo--Turner2016 G
CARD11     2-1342-003chr7:
2974946-2974946
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CARD11     AU4315302chr7:
3123928-3123928
CTintergenicDe novo--Yuen2017 G
CARD11     14637.p1chr7:
2965360-2965360
AGintronicDe novo--Turner2016 G
CARD11     2-0022-005chr7:
3111216-3111218
AACAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More