or
or
Exact

Results for "MAD1L1"

Variant Events: 26

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MAD1L1     3-0469-000chr7:
2137759-2137759
CTintronicDe novo--Yuen2017 G
MAD1L1     11135.p1chr7:
2035905-2035906
TCTintronicMaternal--Wilfert2021 G
MAD1L1     1-0558-003chr7:
1915815-1915815
GAintronicDe novo--Yuen2017 G
MAD1L1     AU3451301chr7:
2086956-2086956
GAintronicDe novo--Yuen2017 G
MAD1L1     1-0412-003chr7:
2223986-2223986
ATintronicDe novo--Yuen2017 G
MAD1L1     2-1383-003chr7:
2244446-2244448
GAAGAintronicDe novo--Yuen2017 G
MAD1L1     2-0007-004chr7:
1928026-1928026
GGGCTGCCintronicDe novo--Yuen2017 G
MAD1L1     1501JS0014chr7:
2041753-2041753
GAexonicDe novostopgainNM_001304524
NM_001304523
NM_001013836
NM_001013837
NM_003550
c.C1087T
c.C1363T
c.C1363T
c.C1363T
c.C1363T
p.Q363X
p.Q455X
p.Q455X
p.Q455X
p.Q455X
44.0-DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
MAD1L1     1-0756-003chr7:
2081673-2081673
CGintronicDe novo--Yuen2017 G
MAD1L1     2-0295-004chr7:
2099901-2099901
CCGCCGATintronicDe novo--Yuen2017 G
MAD1L1     AU4060306chr7:
1964490-1964490
CAintronicDe novo--Yuen2017 G
MAD1L1     2-1427-003chr7:
2088710-2088712
CAACAintronicDe novo--Yuen2017 G
MAD1L1     7-0219-003chr7:
2048239-2048239
GAintronicDe novo--Yuen2017 G
MAD1L1     1-0150-004chr7:
2210130-2210130
GAintronicDe novo--Yuen2017 G
MAD1L1     AU3154302chr7:
2055867-2055867
GAintronicDe novo--Yuen2017 G
MAD1L1     1-0158-012chr7:
2021188-2021190
CAACintronicDe novo--Yuen2017 G
MAD1L1     AU2139305chr7:
2239766-2239766
GAintronicDe novo--Yuen2017 G
MAD1L1     2-1327-004chr7:
2057649-2057649
GAintronicDe novo--Yuen2017 G
MAD1L1     AU2495301chr7:
2008779-2008779
GCintronicDe novo--Yuen2017 G
MAD1L1     2-1509-003chr7:
2136436-2136436
GAintronicDe novo--Yuen2017 G
MAD1L1     2-1356-003chr7:
1927950-1927962
ATGTGTGTGTGTGATGTGTGTGTGintronicDe novo--Yuen2017 G
MAD1L1     3-0185-000chr7:
1926293-1926293
CAintronicDe novo--Yuen2017 G
MAD1L1     7-0197-003chr7:
2055340-2055340
TGintronicDe novo--Yuen2017 G
MAD1L1     5-0095-003chr7:
2066893-2066893
CTintronicDe novo--Yuen2017 G
MAD1L1     2-1153-003chr7:
2250455-2250455
GAintronicDe novo--Yuen2016 G
Yuen2017 G
MAD1L1     14637.p1chr7:
2074865-2074865
GAintronicDe novo--Turner2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More