or
or
Exact

Results for "UTRN"

Variant Events: 62

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
UTRN     1-0184-003chr6:
145898226-145898226
CTintergenicDe novo--Yuen2017 G
UTRN     PN400480chr6:
144835942-144835942
ACexonicUnknownnonsynonymous SNVNM_007124c.A5230Cp.I1744L23.70.0013Leblond2019 E
UTRN     1-0971-003chr6:
145565511-145565513
GTTGTintergenicDe novo--Yuen2017 G
UTRN     PN400281chr6:
144835864-144835864
CTexonicUnknownnonsynonymous SNVNM_007124c.C5152Tp.R1718C18.952.472E-5Leblond2019 E
UTRN     1-0435-003chr6:
144925752-144925752
TAintronicDe novo--Yuen2017 G
UTRN     2-0299-003chr6:
145903878-145903878
TCintergenicDe novo--Yuen2017 G
UTRN     2-0704-003chr6:
145428487-145428487
ACintergenicDe novo--Yuen2017 G
UTRN     AU2793301chr6:
145728088-145728088
ACintergenicDe novo--Yuen2017 G
UTRN     AU2950301chr6:
145432108-145432108
AGintergenicDe novo--Yuen2017 G
UTRN     1-0282-003chr6:
145128013-145128013
ATintronicDe novo--Yuen2017 G
UTRN     11002.p1chr6:
145093200-145093200
CTintronicDe novo--Turner2016 G
UTRN     7-0023-003chr6:
145251491-145251491
GTintergenicDe novo--Yuen2017 G
UTRN     2-1167-003chr6:
145619186-145619186
GAintergenicDe novo--Yuen2017 G
UTRN     AU3517302chr6:
145500454-145500454
CGintergenicDe novo--Yuen2017 G
UTRN     PN400524chr6:
144835942-144835942
ACexonicUnknownnonsynonymous SNVNM_007124c.A5230Cp.I1744L23.70.0013Leblond2019 E
UTRN     Cukier2014:3836chr6:
144811319-144811319
AGexonicUnknownnonsynonymous SNVNM_007124c.A4247Gp.Q1416R14.440.0076Cukier2014 E
UTRN     2-0088-003chr6:
144995237-144995237
TTAACCintronicDe novo--Yuen2017 G
UTRN     Cukier2014:7936chr6:
144854342-144854342
GAexonicUnknownnonsynonymous SNVNM_007124c.G6179Ap.G2060D14.10.0091Cukier2014 E
UTRN     7-0078-003chr6:
145665796-145665796
AGintergenicDe novo--Yuen2017 G
UTRN     14407.p1chr6:
144803437-144803437
CTexonicDe novosynonymous SNVNM_007124c.C3600Tp.G1200G--Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
UTRN     11028.p1chr6:
144852170-144852170
TGintronicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
UTRN     11040.p1chr6:
145079042-145079042
AGintronicDe novo-4.963E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
UTRN     AU4129303chr6:
145411376-145411376
TCintergenicDe novo--Yuen2017 G
UTRN     2-0132-004chr6:
145389287-145389287
CTintergenicDe novo--Yuen2017 G
UTRN     09C81124chr6:
144811185-144811185
CAintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
UTRN     2-0285-003chr6:
145031734-145031734
AGintronicDe novo--Yuen2017 G
UTRN     7-0095-003chr6:
144812121-144812121
CTexonicDe novosynonymous SNVNM_007124c.C4320Tp.F1440F-1.659E-5Yuen2017 G
UTRN     1-0004-003chr6:
145675892-145675892
TGintergenicDe novo--Yuen2017 G
UTRN     1-0138-003chr6:
144840079-144840079
CTintronicDe novo--Yuen2017 G
UTRN     2-1261-004chr6:
144828187-144828187
GGATTCintronicDe novo--Yuen2017 G
UTRN     1-0112-004chr6:
145807552-145807552
CCTTTTCATATAGintergenicDe novo--Yuen2017 G
UTRN     1-0150-003chr6:
145128013-145128013
ATintronicDe novo--Yuen2017 G
UTRN     PN400412chr6:
144835942-144835942
ACexonicUnknownnonsynonymous SNVNM_007124c.A5230Cp.I1744L23.70.0013Leblond2019 E
UTRN     1-0044-003chr6:
145918321-145918321
CTintergenicDe novo--Yuen2017 G
UTRN     5-0026-003chr6:
145020952-145020952
AGintronicDe novo--Yuen2017 G
UTRN     5-0026-003chr6:
145662570-145662570
ATintergenicDe novo--Yuen2017 G
UTRN     SP0002284chr6:
144747566-144747566
CTexonicDe novosynonymous SNVNM_007124c.C549Tp.L183L-3.336E-5Feliciano2019 E
UTRN     2-1456-003chr6:
144898269-144898269
TAexonicDe novononsynonymous SNVNM_007124c.T7324Ap.W2442R5.983-Yuen2017 G
UTRN     1-0546-003chr6:
145851191-145851191
TGintergenicDe novo--Yuen2017 G
UTRN     1-0112-003chr6:
145807552-145807552
CCTTTTCATATAGintergenicDe novo--Yuen2017 G
UTRN     1-0226-005chr6:
144800199-144800199
TCintronicDe novo--Yuen2017 G
UTRN     2-0198-003chr6:
145254160-145254160
GAintergenicDe novo--Yuen2017 G
UTRN     A5chr6:
144967171-144967171
AGintronicDe novo--Wu2018 G
UTRN     AU075803chr6:
145705403-145705403
CTintergenicDe novo--Yuen2017 G
UTRN     1-0885-003chr6:
145112624-145112624
CTintronicDe novo--Yuen2017 G
UTRN     2-1292-003chr6:
145385647-145385647
GAintergenicDe novo--Yuen2017 G
UTRN     1-0489-003chr6:
145642781-145642781
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
UTRN     iHART2061chr6:
144852187-144852187
GAsplicingPaternalsplicing27.04.0E-4Ruzzo2019 G
UTRN     1-0025-004chr6:
144977393-144977393
GAintronicDe novo--Yuen2017 G
UTRN     2-0045-003chr6:
145396424-145396424
GAintergenicDe novo--Yuen2017 G
UTRN     1-0051-005chr6:
145338174-145338174
GCintergenicDe novo--Yuen2017 G
UTRN     AU3951301chr6:
145426942-145426942
TAintergenicDe novo--Yuen2017 G
UTRN     1-0219-003chr6:
145522125-145522125
CTintergenicDe novo--Yuen2017 G
UTRN     2-1261-003chr6:
144828187-144828187
GGATTCintronicDe novo--Yuen2017 G
UTRN     7-0242-003chr6:
145923999-145923999
ATintergenicDe novo--Yuen2017 G
UTRN     2-1508-003chr6:
145569390-145569390
GAintergenicDe novo--Yuen2017 G
UTRN     PN400179chr6:
144835942-144835942
ACexonicUnknownnonsynonymous SNVNM_007124c.A5230Cp.I1744L23.70.0013Leblond2019 E
UTRN     2-1280-003chr6:
145474571-145474585
CATATATATATATATCATATATATATATintergenicDe novo--Yuen2017 G
UTRN     09C89011chr6:
144747566-144747566
CTexonicDe novosynonymous SNVNM_007124c.C549Tp.L183L-3.336E-5DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
UTRN     AU4176302chr6:
145196673-145196673
CTintergenicDe novo--Yuen2017 G
UTRN     1-0092-004chr6:
145858751-145858751
AGintergenicDe novo--Yuen2017 G
UTRN     AU2485305chr6:
145192567-145192567
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More