or
or
Exact

Results for "TCP10"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TCP10     1-0213-004chr6:
168051057-168051057
CTintergenicDe novo--Yuen2017 G
TCP10     2-1210-003chr6:
167849192-167849192
AGintergenicDe novo--Yuen2017 G
TCP10     AU2777302chr6:
167936969-167936969
CTintergenicDe novo--Yuen2017 G
TCP10     1-0382-003chr6:
168042180-168042180
AGintergenicDe novo--Yuen2017 G
TCP10     2-0306-004chr6:
168043423-168043438
AGTGTGTGTGTGTGTGAGTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
TCP10     7-0167-003chr6:
167786976-167786976
CTintronicDe novo--Yuen2017 G
TCP10     AU3636302chr6:
167876127-167876127
GAintergenicDe novo--Yuen2017 G
TCP10     2-1509-003chr6:
168049284-168049284
CGintergenicDe novo--Yuen2017 G
TCP10     2-0296-003chr6:
168052735-168052739
GTACAGintergenicDe novo--Yuen2017 G
TCP10     12498.p1chr6:
167847325-167847325
CTintergenicDe novo--Turner2016 G
TCP10     5-0077-004chr6:
167896269-167896271
TACTintergenicDe novo--Yuen2017 G
TCP10     2-1428-003chr6:
167810011-167810011
CTintergenicDe novo--Yuen2017 G
TCP10     1-0402-003chr6:
167905301-167905301
GGCACACACACTCCCAintergenicDe novo--Yuen2017 G
TCP10     11736.p1chr6:
167874299-167874299
CTintergenicDe novo--Werling2018 G
TCP10     2-1409-003chr6:
167820074-167820074
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
TCP10     AU3052302chr6:
167889189-167889189
GTintergenicDe novo--Yuen2017 G
TCP10     1-0213-003chr6:
168051057-168051057
CTintergenicDe novo--Yuen2016 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More