or
or
Exact

Results for "RPS6KA2"

Variant Events: 36

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
RPS6KA2     3-0111-000chr6:
167173160-167173161
CTCintronicDe novo--Yuen2016 G
RPS6KA2     1-0274-003chr6:
167152733-167152733
TCintronicDe novo--Yuen2017 G
RPS6KA2     2-0149-004chr6:
166951947-166951947
CTintronicDe novo--Yuen2017 G
RPS6KA2     AU3617302chr6:
167202162-167202162
CTintronicDe novo--Yuen2017 G
RPS6KA2     1-0863-003chr6:
166848435-166848435
CTintronicDe novo--Yuen2017 G
RPS6KA2     AU3053301chr6:
167013202-167013202
AGintronicDe novo--Yuen2017 G
RPS6KA2     2-1441-003chr6:
167243567-167243567
CTintronicDe novo--Yuen2016 G
Yuen2017 G
RPS6KA2     2-1174-006chr6:
167250028-167250028
TCintronicDe novo--Yuen2017 G
RPS6KA2     3-0396-000chr6:
167125812-167125812
CTintronicDe novo--Yuen2016 G
RPS6KA2     AU4473301chr6:
167105406-167105406
CTintronicDe novo--Yuen2017 G
RPS6KA2     2-0122-004chr6:
167065953-167065953
GAintronicDe novo--Yuen2017 G
RPS6KA2     2-1529-003chr6:
166934921-166934921
TCintronicDe novo--Yuen2017 G
RPS6KA2     7-0130-003chr6:
167268863-167268866
GGAAGintronicDe novo--Yuen2017 G
RPS6KA2     12657.p1chr6:
166831695-166831695
GTintronicDe novo--Krumm2015 E
RPS6KA2     AU051503chr6:
167174240-167174240
GAintronicDe novo--Yuen2017 G
RPS6KA2     1-0274-004chr6:
167152733-167152733
TCintronicDe novo--Yuen2017 G
RPS6KA2     1-0296-003chr6:
167268863-167268866
GGAAGintronicDe novo--Yuen2017 G
RPS6KA2     1-0566-003chr6:
166993723-166993723
GAintronicDe novo--Yuen2017 G
RPS6KA2     3-0442-000chr6:
166929494-166929494
AGintronicDe novo--Yuen2016 G
Yuen2017 G
RPS6KA2     AU009805chr6:
166823059-166823059
CTUTR3De novo--Yuen2017 G
RPS6KA2     AU056204chr6:
167301260-167301260
TCintergenicDe novo--Yuen2017 G
RPS6KA2     2-0303-004chr6:
166863601-166863601
GGAintronicDe novo--Yuen2017 G
RPS6KA2     AU3727302chr6:
167007676-167007676
CTintronicDe novo--Yuen2017 G
RPS6KA2     5-0015-003chr6:
166984927-166984927
CTintronicDe novo--Yuen2017 G
RPS6KA2     AU3727302chr6:
167110522-167110522
ACintronicDe novo--Yuen2017 G
RPS6KA2     09C95821chr6:
166836835-166836835
CTexonicDe novononsynonymous SNVNM_021135
NM_001006932
c.G1652A
c.G1676A
p.R551Q
p.R559Q
20.68.254E-6Satterstrom2020 E
RPS6KA2     13324.p1chr6:
166909322-166909322
GAintronicDe novo--Turner2016 G
RPS6KA2     2-1290-004chr6:
167173966-167173966
GTintronicDe novo--Yuen2017 G
RPS6KA2     AU058103chr6:
166880827-166880827
CTintronicDe novo--Yuen2017 G
RPS6KA2     2-1357-003chr6:
167226054-167226061
GAAATCCTGintronicDe novo--Yuen2017 G
RPS6KA2     1-0141-003chr6:
167016768-167016768
CAintronicDe novo--Yuen2017 G
RPS6KA2     1-0385-003chr6:
167121291-167121291
ACintronicDe novo--Yuen2017 G
RPS6KA2     2-0063-005chr6:
166918915-166918915
CTintronicDe novo--Yuen2017 G
RPS6KA2     2-0244-003chr6:
166879179-166879189
ATTTCTCTCTCAintronicDe novo--Yuen2017 G
RPS6KA2     2-1341-004chr6:
166863493-166863493
GGAGGACCGCCATGGGAACCACCATintronicDe novo--Yuen2017 G
RPS6KA2     AU4273304chr6:
166998247-166998247
GTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More