or
or
Exact

Results for "ANKRD7"

Variant Events: 55

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ANKRD7     A2chr7:
119207046-119207046
AGintergenicDe novo--Wu2018 G
ANKRD7     AU4433301chr7:
118823160-118823160
TAintergenicDe novo--Yuen2017 G
ANKRD7     AU051504chr7:
118272144-118272144
GAintergenicDe novo--Yuen2017 G
ANKRD7     2-0036-003chr7:
118661572-118661572
CTintergenicDe novo--Yuen2016 G
ANKRD7     1-0593-003chr7:
119188199-119188199
GTintergenicDe novo--Yuen2017 G
ANKRD7     AU066404chr7:
117917499-117917520
TTTTGTTTGTTTGTTTGTTTGTTTTTGTTTGTTTGTTTGTintergenicDe novo--Yuen2017 G
ANKRD7     AU4336301chr7:
118877609-118877609
CGintergenicDe novo--Yuen2017 G
ANKRD7     1-0019-004chr7:
117965061-117965061
CTintergenicDe novo--Yuen2017 G
ANKRD7     AU4283301chr7:
118381119-118381119
TCintergenicDe novo--Yuen2017 G
ANKRD7     2-1384-003chr7:
118710437-118710437
CTintergenicDe novo--Yuen2017 G
ANKRD7     1-0914-003chr7:
118951044-118951044
CTintergenicDe novo--Yuen2017 G
ANKRD7     AU3124304chr7:
118476650-118476650
TCintergenicDe novo--Yuen2017 G
ANKRD7     2-0198-005chr7:
119085831-119085831
GAintergenicDe novo--Yuen2017 G
ANKRD7     2-1220-003chr7:
119156019-119156019
TCintergenicDe novo--Yuen2017 G
ANKRD7     1-0495-003chr7:
118435941-118435941
TAintergenicDe novo--Yuen2017 G
ANKRD7     2-1146-003chr7:
118503906-118503906
TCintergenicDe novo--Yuen2017 G
ANKRD7     1-0441-003chr7:
118769128-118769128
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
ANKRD7     AU2975302chr7:
118232817-118232817
GTintergenicDe novo--Yuen2017 G
ANKRD7     AU2495302chr7:
119146914-119146914
GTintergenicDe novo--Yuen2017 G
ANKRD7     2-1408-004chr7:
119217630-119217630
TGintergenicDe novo--Yuen2017 G
ANKRD7     AU2023302chr7:
118071416-118071416
GAintergenicDe novo--Yuen2017 G
ANKRD7     2-0016-003chr7:
118661572-118661572
CTintergenicDe novo--Yuen2017 G
ANKRD7     AU3729303chr7:
118857655-118857655
GAintergenicDe novo--Yuen2017 G
ANKRD7     AU011704chr7:
118649230-118649230
CTintergenicDe novo--Yuen2017 G
ANKRD7     1-0443-003chr7:
118799679-118799679
ATintergenicDe novo--Yuen2016 G
ANKRD7     1-0912-003chr7:
119256516-119256516
CTintergenicDe novo--Yuen2017 G
ANKRD7     2-0272-004chr7:
119218043-119218043
AGintergenicDe novo--Yuen2017 G
ANKRD7     2-0198-004chr7:
119085831-119085831
GAintergenicDe novo--Yuen2017 G
ANKRD7     1-0652-004chr7:
118366491-118366491
GTintergenicDe novo--Yuen2017 G
ANKRD7     AU4410302chr7:
119101517-119101517
TCintergenicDe novo--Yuen2017 G
ANKRD7     2-1322-003chr7:
118449784-118449784
GAintergenicDe novo--Yuen2017 G
ANKRD7     13942.p1chr7:
117913687-117913687
GTintergenicDe novo--Turner2016 G
ANKRD7     1-0546-003chr7:
118704059-118704059
CTintergenicDe novo--Yuen2017 G
ANKRD7     2-1644-004chr7:
118722650-118722650
AGintergenicDe novo--Yuen2017 G
ANKRD7     74-0117chr7:
118649230-118649230
CTintergenicDe novo--Michaelson2012 G
ANKRD7     AU015903chr7:
118989045-118989045
CTintergenicDe novo--Yuen2017 G
ANKRD7     2-0198-003chr7:
119085831-119085831
GAintergenicDe novo--Yuen2017 G
ANKRD7     1-0560-003chr7:
118603819-118603819
AGintergenicDe novo--Yuen2017 G
ANKRD7     2-1325-003chr7:
118077826-118077826
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ANKRD7     AU072505chr7:
118302195-118302195
AGintergenicDe novo--Yuen2017 G
ANKRD7     AU4197302chr7:
119118250-119118250
TAintergenicDe novo--Yuen2017 G
ANKRD7     1-0285-003chr7:
118267216-118267216
GTintergenicDe novo--Yuen2017 G
ANKRD7     1-0413-003chr7:
118112365-118112365
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
ANKRD7     1-0606-003chr7:
117899210-117899210
AGintergenicDe novo--Yuen2017 G
ANKRD7     7-0103-003chr7:
119045702-119045709
CTTTTTTTCTTTTTTintergenicDe novo--Yuen2017 G
ANKRD7     AU4092302chr7:
118712196-118712196
TCintergenicDe novo--Yuen2017 G
ANKRD7     1-0045-004chr7:
118386099-118386099
TCintergenicDe novo--Yuen2017 G
ANKRD7     2-0135-004chr7:
118757772-118757772
TTAAintergenicDe novo--Yuen2017 G
ANKRD7     1-0278-003chr7:
118396267-118396267
CTintergenicDe novo--Yuen2016 G
ANKRD7     1-0522-003chr7:
118020905-118020905
CTintergenicDe novo--Yuen2016 G
ANKRD7     1-0065-004chr7:
118598076-118598076
AGintergenicDe novo--Yuen2017 G
ANKRD7     AU2117302chr7:
118148483-118148483
AGintergenicDe novo--Yuen2017 G
ANKRD7     1-0107-003chr7:
118038109-118038109
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
ANKRD7     AU4423303chr7:
118060219-118060228
CATATATATACATATATATATAintergenicDe novo--Yuen2017 G
ANKRD7     1-0330-004chr7:
117865558-117865558
TAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More