or
or
Exact

Results for "PDE1C"

Variant Events: 57

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PDE1C     2-1174-005Bchr7:
32347441-32347441
AATintergenicDe novo--Yuen2017 G
PDE1C     2-1283-003chr7:
32393196-32393196
TAintergenicDe novo--Yuen2017 G
PDE1C     1-0412-003chr7:
32393247-32393247
AGintergenicDe novo--Yuen2017 G
PDE1C     1-0126-003chr7:
32054602-32054602
CTintronicDe novo--Yuen2017 G
PDE1C     2-1176-003chr7:
32393247-32393247
AGintergenicDe novo--Yuen2017 G
PDE1C     1-0835-003chr7:
32003463-32003463
TCintronicDe novo--Yuen2017 G
PDE1C     2-0057-003chr7:
32393211-32393211
TAintergenicDe novo--Yuen2017 G
PDE1C     5-0055-003chr7:
31834379-31834379
AGintronicDe novo--Yuen2017 G
PDE1C     AU3057301chr7:
32008259-32008259
GAintronicDe novo--Yuen2017 G
PDE1C     2-1174-006chr7:
32347441-32347441
AATintergenicDe novo--Yuen2017 G
PDE1C     2-1174-006chr7:
32262067-32262067
TCintronicDe novo--Yuen2017 G
PDE1C     AU3724302chr7:
32023522-32023522
TCintronicDe novo--Yuen2017 G
PDE1C     2-1296-003chr7:
32241535-32241535
CTintronicDe novo--Yuen2017 G
PDE1C     1-0300-003chr7:
32442240-32442240
CTintergenicDe novo--Yuen2017 G
PDE1C     AU1987302chr7:
32348178-32348178
CTintergenicDe novo--Yuen2017 G
PDE1C     5-0084-003chr7:
32393196-32393196
TAintergenicDe novo--Yuen2017 G
PDE1C     72-1397chr7:
31917646-31917646
CGexonicInheritednonsynonymous SNVNM_001191056
NM_001191057
NM_001191058
NM_001191059
NM_005020
c.G429C
c.G429C
c.G609C
c.G429C
c.G429C
p.M143I
p.M143I
p.M203I
p.M143I
p.M143I
19.19-Patowary2019 E
PDE1C     5-0147-003chr7:
31867333-31867333
GCintronicDe novo--Yuen2017 G
PDE1C     5-0050-004chr7:
32393196-32393196
TAintergenicDe novo--Yuen2017 G
PDE1C     2-1278-003chr7:
32094245-32094245
AGintronicDe novo--Yuen2016 G
Yuen2017 G
PDE1C     AU3302302chr7:
32103873-32103873
CTintronicDe novo--Yuen2017 G
PDE1C     2-1333-003chr7:
32200191-32200191
CTintronicDe novo--Yuen2017 G
PDE1C     3-0438-000chr7:
32240156-32240156
CTintronicDe novo--Yuen2016 G
PDE1C     1-0024-003chr7:
32226459-32226459
GCintronicDe novo--Yuen2017 G
PDE1C     1-0075-003chr7:
31969352-31969352
ACintronicDe novo--Yuen2017 G
PDE1C     13322.p1chr7:
31855578-31855578
GTexonicMosaicnonsynonymous SNVNM_001191056
NM_001191057
NM_001191058
NM_001191059
NM_005020
c.C1773A
c.C1773A
c.C1953A
c.C1773A
c.C1773A
p.N591K
p.N591K
p.N651K
p.N591K
p.N591K
6.943-Krupp2017 E
PDE1C     2-1266-003chr7:
31875463-31875477
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
PDE1C     1-0271-003chr7:
32393196-32393196
TAintergenicDe novo--Yuen2017 G
PDE1C     7-0059-003chr7:
32393196-32393196
TAintergenicDe novo--Yuen2017 G
PDE1C     PN400186chr7:
31867960-31867960
GAexonicUnknownnonsynonymous SNVNM_001191056
NM_001191057
NM_001191058
NM_001191059
NM_005020
c.C1231T
c.C1231T
c.C1411T
c.C1231T
c.C1231T
p.P411S
p.P411S
p.P471S
p.P411S
p.P411S
32.0-Leblond2019 E
PDE1C     1-0458-003chr7:
32347441-32347441
AATintergenicDe novo--Yuen2017 G
PDE1C     2-0242-004chr7:
32423012-32423012
ACintergenicDe novo--Yuen2017 G
PDE1C     2-1501-003chr7:
31800442-31800442
AGintronicDe novo--Yuen2017 G
PDE1C     F2-003chr7:
32209524-32209524
GCexonicPaternalnonsynonymous SNVNM_001191058c.C181Gp.L61V18.882.608E-5Vaags2012 E
PDE1C     2-1066-003chr7:
31800701-31800701
CCCTCTTintronicDe novo--Yuen2017 G
PDE1C     1-0534-004chr7:
32303517-32303521
GTCTCGintronicDe novo--Yuen2017 G
PDE1C     AU031203chr7:
32144358-32144358
CTintronicDe novo--Yuen2017 G
PDE1C     2-1416-004chr7:
32347441-32347441
AATintergenicDe novo--Yuen2017 G
PDE1C     1-0161-004chr7:
32393211-32393211
TAintergenicDe novo--Yuen2017 G
PDE1C     AU4284301chr7:
32447341-32447341
AGintergenicDe novo--Yuen2017 G
PDE1C     1-0595-004chr7:
31800701-31800701
CCCTCTTintronicDe novo--Yuen2017 G
PDE1C     1-0744-003chr7:
32301106-32301106
CTintronicDe novo--Yuen2017 G
PDE1C     2-1292-003chr7:
32352209-32352209
ACintergenicDe novo--Yuen2017 G
PDE1C     AU2988303chr7:
31968554-31968554
CTintronicDe novo--Yuen2017 G
PDE1C     12795.p1chr7:
32366004-32366004
GAintergenicDe novo--Turner2016 G
PDE1C     1-0401-003chr7:
32018207-32018207
ACintronicDe novo--Yuen2017 G
PDE1C     2-1261-003chr7:
31940454-31940454
TCintronicDe novo--Yuen2017 G
PDE1C     11456.p1chr7:
32151326-32151326
AGintronicDe novo--Turner2016 G
PDE1C     AU2495301chr7:
32300336-32300336
AGintronicDe novo--Yuen2017 G
PDE1C     1-0321-004chr7:
32393211-32393211
TAintergenicDe novo--Yuen2017 G
PDE1C     AU2140305chr7:
32252892-32252892
GAintronicDe novo--Yuen2017 G
PDE1C     AU3368302chr7:
32420866-32420866
GAintergenicDe novo--Yuen2017 G
PDE1C     A9chr7:
32430235-32430237
GATGintergenicDe novo--Wu2018 G
PDE1C     2-0202-004chr7:
31991538-31991538
CAintronicDe novo--Yuen2017 G
PDE1C     5-0015-003chr7:
32203100-32203100
GAintronicDe novo--Yuen2017 G
PDE1C     2-1605-003chr7:
32042492-32042492
TCintronicDe novo--Yuen2017 G
PDE1C     AU3721302chr7:
32369840-32369840
GAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More