or
or
Exact

Results for "NRCAM"

Variant Events: 20

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NRCAM     2-1425-004chr7:
107981533-107981533
TCintronicDe novo--Yuen2017 G
NRCAM     3-0447-000chr7:
107994791-107994791
GAintronicDe novo--Yuen2017 G
NRCAM     2-0244-003chr7:
107833860-107833860
CTintronicDe novo--Yuen2017 G
NRCAM     1-0539-003chr7:
107977873-107977873
GAintronicDe novo--Yuen2017 G
NRCAM     2-1160-003chr7:
108006487-108006487
GAintronicDe novo--Yuen2016 G
Yuen2017 G
NRCAM     1-0332-003chr7:
107847659-107847659
AGintronicDe novo--Yuen2017 G
NRCAM     3-0307-000chr7:
107802650-107802650
TCintronicDe novo--Yuen2017 G
NRCAM     1-0446-003chr7:
107933146-107933146
AGintronicDe novo--Yuen2017 G
NRCAM     1-0595-004chr7:
107939583-107939583
AAAAGintronicDe novo--Yuen2017 G
NRCAM     1-0218-004chr7:
108090583-108090583
CTintronicDe novo--Yuen2017 G
NRCAM     13964.p1chr7:
107810334-107810334
TCintronicDe novo--Turner2016 G
NRCAM     1-0261-004chr7:
108051044-108051044
GAintronicDe novo--Yuen2017 G
NRCAM     AU2123301chr7:
108026407-108026407
GAintronicDe novo--Yuen2017 G
NRCAM     1-0368-004chr7:
108027647-108027650
TTAATintronicDe novo--Yuen2017 G
NRCAM     1-0395-004chr7:
107939595-107939595
AAGintronicDe novo--Yuen2017 G
NRCAM     AU4013303chr7:
108001928-108001928
TCintronicDe novo--Yuen2017 G
NRCAM     AU4269301chr7:
108053302-108053302
TCintronicDe novo--Yuen2017 G
NRCAM     1-0488-003chr7:
108022869-108022869
AGintronicDe novo--Yuen2017 G
NRCAM     Cukier2014:17342chr7:
107822355-107822355
GAexonicUnknownnonsynonymous SNVNM_001037132
NM_005010
NM_001193583
NM_001193584
NM_001193582
c.C2557T
c.C2509T
c.C2500T
c.C2500T
c.C2557T
p.R853C
p.R837C
p.R834C
p.R834C
p.R853C
14.442.0E-4Cukier2014 E
NRCAM     AU059903chr7:
108084421-108084436
TAGAGAGAGAGAGAGATAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More