or
or
Exact

Results for "IGFBP3"

Variant Events: 57

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
IGFBP3     1-0512-003chr7:
46427076-46427076
AGintergenicDe novo--Yuen2017 G
IGFBP3     2-1313-003chr7:
46649464-46649464
TCintergenicDe novo--Yuen2017 G
IGFBP3     2-0219-004chr7:
46201674-46201674
GTintergenicDe novo--Yuen2017 G
IGFBP3     G01-GEA-313_HIchr7:
46729132-46729132
TTCGGCCGGGCGCGGTGGCTCACGCintergenicDe novo--Satterstrom2020 E
IGFBP3     2-1206-003chr7:
46603814-46603814
GAintergenicDe novo--Yuen2017 G
IGFBP3     2-1277-004chr7:
45962091-45962091
GTintergenicDe novo--Yuen2017 G
IGFBP3     AU2129301chr7:
46228556-46228556
TCintergenicDe novo--Yuen2017 G
IGFBP3     2-1206-003chr7:
46184144-46184144
ATintergenicDe novo--Yuen2017 G
IGFBP3     5-0045-003chr7:
46331288-46331288
GAintergenicDe novo--Yuen2017 G
IGFBP3     13651.p1chr7:
47089316-47089316
CGintergenicDe novo--Werling2018 G
IGFBP3     AU024607chr7:
47007257-47007257
AGintergenicDe novo--Yuen2017 G
IGFBP3     1-0489-003chr7:
46685797-46685813
AACACACACACACACACAACACACACACACACintergenicDe novo--Yuen2017 G
IGFBP3     2-1290-003chr7:
46512506-46512506
TCintergenicDe novo--Yuen2017 G
IGFBP3     2-1452-003chr7:
47122858-47122858
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
IGFBP3     AU4027306chr7:
46196298-46196298
GAintergenicDe novo--Yuen2017 G
IGFBP3     AU4033305chr7:
46264609-46264609
CTintergenicDe novo--Yuen2017 G
IGFBP3     AU3053301chr7:
46860335-46860335
TAintergenicDe novo--Yuen2017 G
IGFBP3     AU4150301chr7:
46890514-46890514
GAintergenicDe novo--Yuen2017 G
IGFBP3     2-1715-004chr7:
46021706-46021706
CTintergenicDe novo--Yuen2017 G
IGFBP3     AU3912301chr7:
45968742-45968742
GAintergenicDe novo--Yuen2017 G
IGFBP3     1-0339-003chr7:
45980064-45980064
CGintergenicDe novo--Yuen2017 G
IGFBP3     5-0050-004chr7:
47214748-47214748
ATintergenicDe novo--Yuen2017 G
IGFBP3     AU3605303chr7:
46644911-46644911
CAintergenicDe novo--Yuen2017 G
IGFBP3     1-0004-003chr7:
46570237-46570237
AGintergenicDe novo--Yuen2017 G
IGFBP3     1-0433-004chr7:
47150622-47150622
TCintergenicDe novo--Yuen2017 G
IGFBP3     1-0347-003chr7:
46958026-46958026
GCintergenicDe novo--Yuen2017 G
IGFBP3     2-1212-003chr7:
46053418-46053418
AGintergenicDe novo--Yuen2017 G
IGFBP3     2-1299-003chr7:
46132013-46132013
CTintergenicDe novo--Yuen2017 G
IGFBP3     2-0070-004chr7:
46645681-46645681
AACAACTTCintergenicDe novo--Yuen2017 G
IGFBP3     AU066206chr7:
46911725-46911731
ATTTTTTATTTTTTTintergenicDe novo--Yuen2017 G
IGFBP3     2-0022-005chr7:
46780744-46780744
GAintergenicDe novo--Yuen2017 G
IGFBP3     1-0186-005chr7:
46399186-46399186
AGintergenicDe novo--Yuen2017 G
IGFBP3     1-0338-005chr7:
46817432-46817432
GTintergenicDe novo--Yuen2017 G
IGFBP3     1-0777-003chr7:
46866629-46866629
TCintergenicDe novo--Yuen2017 G
IGFBP3     2-0307-004chr7:
47239887-47239887
ATintergenicDe novo--Yuen2017 G
IGFBP3     1-0609-003chr7:
47161967-47161967
CTintergenicDe novo--Yuen2017 G
IGFBP3     AU1795301chr7:
46229155-46229155
AGintergenicDe novo--Yuen2017 G
IGFBP3     7-0166-003chr7:
46519517-46519517
AGintergenicDe novo--Yuen2017 G
IGFBP3     2-0223-003chr7:
46363284-46363284
GTintergenicDe novo--Yuen2017 G
IGFBP3     AU069603chr7:
46106259-46106259
CTintergenicDe novo--Yuen2017 G
IGFBP3     AU4164301chr7:
46603407-46603407
TCintergenicDe novo--Yuen2017 G
IGFBP3     AU2975301chr7:
47061684-47061684
AGintergenicDe novo--Yuen2017 G
IGFBP3     AU2381302chr7:
45975423-45975423
CTintergenicDe novo--Yuen2017 G
IGFBP3     1-0225-003chr7:
46046320-46046320
CGintergenicDe novo--Yuen2017 G
IGFBP3     1-0329-004chr7:
47118990-47118990
CAintergenicDe novo--Yuen2017 G
IGFBP3     2-1143-003chr7:
46732568-46732568
CAintergenicDe novo1.751-Yuen2017 G
IGFBP3     1-0219-003chr7:
46283016-46283016
CTintergenicDe novo--Yuen2017 G
IGFBP3     2-1205-003chr7:
46981384-46981399
CCTCTCTCTCTCTCTCCCTCTCTCTCTCTCintergenicDe novo--Yuen2017 G
IGFBP3     AU3874302chr7:
46182162-46182162
AGintergenicDe novo--Yuen2017 G
IGFBP3     1-0509-003chr7:
47242536-47242536
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
IGFBP3     1-0107-003chr7:
46186169-46186169
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
IGFBP3     AU3052302chr7:
46857045-46857045
GAintergenicDe novo--Yuen2017 G
IGFBP3     11089.p1chr7:
46401075-46401075
TAintergenicDe novo--Turner2016 G
IGFBP3     2-1722-003chr7:
46244044-46244044
CGintergenicDe novo--Yuen2017 G
IGFBP3     7-0106-003chr7:
47287129-47287129
GAintergenicDe novo--Yuen2017 G
IGFBP3     2-1514-003chr7:
46222555-46222555
GAintergenicDe novo--Yuen2017 G
IGFBP3     AU3052302chr7:
46856334-46856334
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More