or
or
Exact

Results for "SDK1"

Variant Events: 100

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SDK1     1-0439-003chr7:
4509677-4509677
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
SDK1     7-0068-003chr7:
4391539-4391539
ACintergenicDe novo--Yuen2017 G
SDK1     2-1269-003chr7:
3963280-3963280
GTintronicDe novo--Yuen2016 G
Yuen2017 G
SDK1     SSC02395chr7:
3998632-3998632
GAexonicDe novononsynonymous SNVNM_152744c.G1220Ap.G407E0.371-Lim2017 E
SDK1     1-0377-003chr7:
3851269-3851269
AATintronicDe novo--Yuen2017 G
SDK1     2-1729-003chr7:
4176236-4176236
GTintronicDe novo--Yuen2017 G
SDK1     AU3053301chr7:
3509106-3509106
TGintronicDe novo--Yuen2017 G
SDK1     1-0579-003chr7:
3365651-3365651
CTintronicDe novo--Yuen2017 G
SDK1     5-0055-003chr7:
4536925-4536925
TTCintergenicDe novo--Yuen2017 G
SDK1     7-0100-004chr7:
4190409-4190409
AGintronicDe novo--Yuen2017 G
SDK1     2-1235-003chr7:
3605546-3605546
GAintronicDe novo--Yuen2017 G
SDK1     1-0756-004chr7:
3391666-3391666
CTintronicDe novo--Yuen2017 G
SDK1     7-0095-004chr7:
4041433-4041437
TTGTCTintronicDe novo--Yuen2017 G
SDK1     1-0150-004chr7:
3580200-3580200
GTintronicDe novo--Yuen2017 G
SDK1     2-1235-003chr7:
4185819-4185819
CAintronicDe novo--Yuen2017 G
SDK1     2-1322-004chr7:
4607907-4607907
GTintergenicDe novo--Yuen2017 G
SDK1     2-0304-004chr7:
4068186-4068186
AGintronicDe novo--Yuen2017 G
SDK1     7-0059-003chr7:
4649339-4649339
CTintergenicDe novo--Yuen2017 G
SDK1     1-0530-003chr7:
4609020-4609020
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
SDK1     2-1358-003chr7:
4124179-4124179
GAintronicDe novo--Yuen2017 G
SDK1     A26chr7:
3790175-3790175
GCintronicDe novo--Wu2018 G
SDK1     13515.p1chr7:
3627830-3627830
CTintronicDe novo--Turner2016 G
SDK1     1-0534-006chr7:
4096500-4096500
GGACCATTCTGCTCCGGGTCCCGACintronicDe novo--Yuen2017 G
SDK1     12449.p1chr7:
4338607-4338607
AGintergenicDe novo--Turner2016 G
SDK1     AU4067303chr7:
4651492-4651492
AGintergenicDe novo--Yuen2017 G
SDK1     AU3874303chr7:
3470425-3470425
CGintronicDe novo--Yuen2017 G
SDK1     AU4243302chr7:
4033790-4033790
GAintronicDe novo--Yuen2017 G
SDK1     14642.p1chr7:
4423620-4423620
GTintergenicDe novo--Turner2016 G
SDK1     1-0496-003chr7:
4090024-4090024
TCintronicDe novo--Yuen2016 G
Yuen2017 G
SDK1     AU3849302chr7:
4550527-4550527
CTintergenicDe novo--Yuen2017 G
SDK1     12449.p1chr7:
4338614-4338614
TCintergenicDe novo--Turner2016 G
SDK1     12449.p1chr7:
4338619-4338619
AGintergenicDe novo--Turner2016 G
SDK1     2-0298-003chr7:
4119870-4119870
GAintronicDe novo--Yuen2017 G
SDK1     AU4212303chr7:
4713306-4713306
ATintergenicDe novo--Yuen2017 G
SDK1     2-0208-003chr7:
3761627-3761627
TCintronicDe novo--Yuen2017 G
SDK1     AU4410302chr7:
4640692-4640692
AGintergenicDe novo--Yuen2017 G
SDK1     1-0142-005chr7:
3647442-3647443
ACAintronicDe novo--Yuen2017 G
SDK1     1-0272-004chr7:
3562599-3562599
TTGGCintronicDe novo--Yuen2017 G
SDK1     AU1742302chr7:
3536838-3536838
CTintronicDe novo--Yuen2017 G
SDK1     7-0055-003chr7:
4247447-4247447
CTintronicDe novo--Yuen2017 G
SDK1     7-0219-003chr7:
3776106-3776106
GAintronicDe novo--Yuen2017 G
SDK1     1-0209-003chr7:
4667113-4667113
GAintergenicDe novo--Yuen2017 G
SDK1     AU2129303chr7:
3626688-3626688
GAintronicDe novo--Yuen2017 G
SDK1     AU2129303chr7:
4598354-4598354
GCintergenicDe novo--Yuen2017 G
SDK1     2-0135-004chr7:
3444811-3444811
AACintronicDe novo--Yuen2017 G
SDK1     2-1426-003chr7:
4702619-4702619
CTintergenicDe novo--Yuen2017 G
SDK1     2-1283-003chr7:
3393059-3393059
CTintronicDe novo--Yuen2017 G
SDK1     AU3175303chr7:
3589149-3589149
GTintronicDe novo--Yuen2017 G
SDK1     AU021204chr7:
3619028-3619028
AGintronicDe novo--Yuen2017 G
SDK1     2-0244-003chr7:
3953216-3953216
TGintronicDe novo--Yuen2017 G
SDK1     1-1000-003chr7:
4003930-4003930
CTintronicDe novo--Yuen2017 G
SDK1     1-0158-003chr7:
3358641-3358641
TCintronicDe novo--Yuen2017 G
SDK1     1-0906-003chr7:
3896736-3896736
GAintronicDe novo--Yuen2017 G
SDK1     AU4079302chr7:
4311355-4311360
TGGGGGTGGGGintergenicDe novo--Yuen2017 G
SDK1     1-0559-004chr7:
3486880-3486885
ATAACTAintronicDe novo--Yuen2017 G
SDK1     AU3634301chr7:
3542113-3542113
CAintronicDe novo--Yuen2017 G
SDK1     2-1213-003chr7:
3790046-3790046
GTintronicDe novo--Yuen2017 G
SDK1     AU076509chr7:
4513952-4513952
CGintergenicDe novo--Yuen2017 G
SDK1     2-0299-003chr7:
4169725-4169725
CTexonicDe novosynonymous SNVNM_152744c.C4125Tp.D1375D-1.0E-4Yuen2017 G
SDK1     AU076509chr7:
4514394-4514394
TGintergenicDe novo--Yuen2017 G
SDK1     1-0559-004chr7:
3562599-3562599
TTGGCintronicDe novo--Yuen2017 G
SDK1     7-0024-003chr7:
4717509-4717509
TCintergenicDe novo--Yuen2017 G
SDK1     AU025704chr7:
3997003-3997003
GAintronicDe novo--Yuen2017 G
SDK1     1-0382-004chr7:
4123783-4123783
CGintronicDe novo--Yuen2017 G
SDK1     AU4327303chr7:
4085889-4085889
CTintronicDe novo--Yuen2017 G
SDK1     1-0215-006chr7:
3504485-3504488
CAATCintronicDe novo--Yuen2017 G
SDK1     AU076808chr7:
4063890-4063890
GTintronicDe novo--Yuen2017 G
SDK1     1-0465-003chr7:
4363185-4363185
AGintergenicDe novo--Yuen2017 G
SDK1     7-0095-003chr7:
4041433-4041437
TTGTCTintronicDe novo--Yuen2017 G
SDK1     1-0402-003chr7:
3965703-3965703
AGintronicDe novo--Yuen2017 G
SDK1     AU3637301chr7:
4279997-4280000
CTGTCTintronicDe novo--Yuen2017 G
SDK1     2-1731-003chr7:
3561032-3561032
TAintronicDe novo--Yuen2017 G
SDK1     11226.p1chr7:
3998632-3998632
GAexonicDe novononsynonymous SNVNM_152744c.G1220Ap.G407E0.371-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
SDK1     1-0121-003chr7:
4141798-4141799
GCGintronicDe novo--Yuen2017 G
SDK1     2-1085-004chr7:
4123426-4123426
TCintronicDe novo--Yuen2017 G
SDK1     1-0294-003chr7:
3416898-3416898
TCintronicDe novo--Yuen2016 G
Yuen2017 G
SDK1     1-0044-003chr7:
4123470-4123470
TTTTACTTCintronicDe novo--Yuen2017 G
SDK1     AU2000305chr7:
3927413-3927413
GTintronicDe novo--Yuen2017 G
SDK1     2-1314-003chr7:
4184578-4184578
ACintronicDe novo--Yuen2016 G
SDK1     1-0546-003chr7:
4498294-4498294
GTintergenicDe novo--Yuen2017 G
SDK1     2-1283-004chr7:
3393059-3393059
CTintronicDe novo--Yuen2017 G
SDK1     1-0455-003chr7:
4123446-4123446
TTAintronicDe novo--Yuen2017 G
SDK1     1-0404-003chr7:
4169746-4169746
CTintronicDe novo-4.503E-5Yuen2017 G
SDK1     2-1430-003chr7:
3716838-3716852
ATGTGTGTGTGTGTGATGTGTGTGTGTGintronicDe novo--Yuen2017 G
SDK1     AU1987304chr7:
3381161-3381161
CGintronicDe novo--Yuen2017 G
SDK1     AU061104chr7:
3520146-3520146
GAintronicDe novo--Yuen2017 G
SDK1     1-0278-003chr7:
3900431-3900431
CGintronicDe novo--Yuen2016 G
SDK1     1-0079-008chr7:
3414529-3414529
CTintronicDe novo--Yuen2017 G
SDK1     1-0677-003chr7:
4589248-4589248
AGintergenicDe novo--Yuen2017 G
SDK1     3-0216-000chr7:
4667377-4667377
CGintergenicDe novo--Yuen2017 G
SDK1     04C35995chr7:
4002399-4002399
CTexonicDe novononsynonymous SNVNM_152744c.C1345Tp.R449C15.661.703E-5Satterstrom2020 E
SDK1     2-0202-004chr7:
3427363-3427367
CCTGTCintronicDe novo--Yuen2017 G
SDK1     13632.p1chr7:
4215360-4215360
CTintronicDe novo-5.77E-5Satterstrom2020 E
SDK1     AU4007301chr7:
3938122-3938122
TGintronicDe novo--Yuen2017 G
SDK1     2-1120-003chr7:
3766072-3766072
ACintronicDe novo--Yuen2017 G
SDK1     5-0114-003chr7:
4278408-4278408
CTintronicDe novo--Yuen2017 G
SDK1     AU3984301chr7:
4235463-4235463
CTintronicDe novo--Yuen2017 G
SDK1     1-0065-004chr7:
3562599-3562599
TTGGCintronicDe novo--Yuen2017 G
SDK1     1-0286-004chr7:
3405755-3405761
CTCTAATCintronicDe novo--Yuen2017 G
SDK1     AU0786305chr7:
4659031-4659035
GTCTCGTCTCTCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More