or
or
Exact

Results for "TRY2P"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TRY2P    1-0481-003chr7:
142186280-142186280
AGintergenicDe novo--Yuen2017 G
TRY2P    AU005214chr7:
142112173-142112173
CGintergenicDe novo--Yuen2017 G
TRY2P    1-0253-004chr7:
142044053-142044053
GAintergenicDe novo--Yuen2017 G
TRY2P    2-1153-003chr7:
142155433-142155433
AGintergenicDe novo--Yuen2017 G
TRY2P    AU4306302chr7:
141968844-141968844
CTncRNA_exonicDe novo--Yuen2017 G
TRY2P    1-0044-003chr7:
142044624-142044624
TGintergenicDe novo--Yuen2017 G
TRY2P    10C117939chr7:
142247133-142247133
ACintergenicDe novo-9.009E-6Satterstrom2020 E
TRY2P    11220.p1chr7:
142144103-142144103
GTintergenicDe novo-1.0E-4Satterstrom2020 E
TRY2P    2-1436-003chr7:
142344105-142344105
TCintergenicDe novo--Yuen2017 G
TRY2P    13171.p1chr7:
142005576-142005576
CGintergenicDe novo--Turner2016 G
TRY2P    653-04-102262chr7:
142176440-142176440
CTintergenicDe novo-3.377E-5Satterstrom2020 E
TRY2P    13171.p1chr7:
142005580-142005580
CTintergenicDe novo--Turner2016 G
TRY2P    AU1521301chr7:
142047801-142047828
TATATATATGATATATATGATATATATGTATATATATGATATATATGintergenicDe novo--Yuen2017 G
TRY2P    14416.p1chr7:
142111676-142111676
GCintergenicDe novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
TRY2P    14637.p1chr7:
142003968-142003968
CGintergenicDe novo--Turner2016 G
TRY2P    13171.p1chr7:
142005571-142005571
CTintergenicDe novo--Turner2016 G
TRY2P    13649.p1chr7:
142231862-142231862
TCintergenicDe novo--Turner2016 G
TRY2P    1-0253-004chr7:
142042391-142042392
GTGintergenicDe novo--Yuen2017 G
TRY2P    98HI0027Achr7:
142131554-142131554
CAintergenicDe novo-8.442E-6Satterstrom2020 E
TRY2P    12175.p1chr7:
142188162-142188162
CAintergenicDe novo--Turner2016 G
TRY2P    2-0068-003chr7:
142044624-142044624
TGintergenicDe novo--Yuen2017 G
TRY2P    14586.p1chr7:
142045353-142045353
CGintergenicDe novo--Krumm2015 E
TRY2P    13649.p1 Complex Event; expand row to view variants  De novo--Turner2016 G
Turner2016 G
TRY2P    2-1702-004chr7:
142024356-142024356
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More