or
or
Exact

Results for "SEMA3C"

Variant Events: 40

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SEMA3C     1-0092-004chr7:
80702691-80702691
GAintergenicDe novo--Yuen2017 G
SEMA3C     2-0144-004chr7:
80927031-80927031
ACintergenicDe novo--Yuen2017 G
SEMA3C     7-0123-003chr7:
80958496-80958496
AGintergenicDe novo--Yuen2017 G
SEMA3C     1-0354-006chr7:
80675170-80675170
GGTCTGTTintergenicDe novo--Yuen2017 G
SEMA3C     2-1355-004chr7:
80708975-80708975
GAintergenicDe novo--Yuen2017 G
SEMA3C     1-0347-003chr7:
80915679-80915679
ATintergenicDe novo--Yuen2017 G
SEMA3C     2-1436-003chr7:
81157314-81157314
ATintergenicDe novo--Yuen2017 G
SEMA3C     1-0338-005chr7:
80830255-80830255
CTintergenicDe novo--Yuen2017 G
SEMA3C     2-1251-003chr7:
80617719-80617719
CGintergenicDe novo--Yuen2017 G
SEMA3C     2-1148-004chr7:
80675170-80675170
GGTCTGTTintergenicDe novo--Yuen2017 G
SEMA3C     1-0683-004chr7:
80565134-80565134
AAAAATAAAAAAAGATTAATTTTTGintergenicDe novo--Yuen2017 G
SEMA3C     AU3649304chr7:
80579457-80579457
GAintergenicDe novo--Yuen2017 G
SEMA3C     7-0249-003chr7:
81065826-81065826
GCintergenicDe novo--Yuen2017 G
SEMA3C     AU4093304chr7:
81128305-81128305
GCintergenicDe novo--Yuen2017 G
SEMA3C     1-0874-003chr7:
80736536-80736536
AGintergenicDe novo--Yuen2017 G
SEMA3C     2-0007-004chr7:
80584735-80584735
TCintergenicDe novo--Yuen2017 G
SEMA3C     2-1242-003chr7:
80710243-80710243
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
SEMA3C     AU017704chr7:
81065505-81065505
AGintergenicDe novo--Yuen2017 G
SEMA3C     AU017704chr7:
81065523-81065523
TCintergenicDe novo--Yuen2017 G
SEMA3C     AU3809302chr7:
80525415-80525415
TGintronicDe novo--Yuen2017 G
SEMA3C     2-1134-003chr7:
81076902-81076902
TCintergenicDe novo--Yuen2017 G
SEMA3C     AU017704chr7:
81065527-81065527
TCintergenicDe novo--Yuen2017 G
SEMA3C     AU2458303chr7:
81195846-81195846
ATintergenicDe novo--Yuen2017 G
SEMA3C     1-0560-003chr7:
80928940-80928940
ATintergenicDe novo--Yuen2017 G
SEMA3C     AU2139301chr7:
80937894-80937894
TGintergenicDe novo--Yuen2017 G
SEMA3C     AU2975301chr7:
80490714-80490714
GTintronicDe novo--Yuen2017 G
SEMA3C     065-07-107756chr7:
80430173-80430173
TGintronicDe novo--Satterstrom2020 E
SEMA3C     5-0116-003chr7:
80844126-80844126
CTintergenicDe novo--Yuen2017 G
SEMA3C     13298.p1chr7:
80584667-80584667
ACintergenicDe novo--Turner2016 G
SEMA3C     2-1252-003chr7:
80385077-80385077
TCintronicDe novo--Yuen2017 G
SEMA3C     2-1567-004chr7:
80584918-80584918
GAintergenicDe novo--Yuen2017 G
SEMA3C     5-0065-003chr7:
80691575-80691575
AACTGintergenicDe novo--Yuen2017 G
SEMA3C     1-0806-003chr7:
80677919-80677919
GTintergenicDe novo--Yuen2017 G
SEMA3C     AU2569301chr7:
81012978-81012978
CTintergenicDe novo--Yuen2017 G
SEMA3C     NDAR_INVCN331JT9_wes1chr7:
80418846-80418850
TAGAATintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
SEMA3C     A31chr7:
80431347-80431347
TCintronicDe novo--Wu2018 G
SEMA3C     1-0214-003chr7:
80862311-80862311
GAintergenicDe novo--Yuen2017 G
SEMA3C     2-1169-003chr7:
80431458-80431458
GCintronicDe novo--Yuen2017 G
SEMA3C     2-1408-004chr7:
80575190-80575190
GAintergenicDe novo--Yuen2017 G
SEMA3C     1-0497-003chr7:
80384591-80384591
AGintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More