or
or
Exact

Results for "ARL4A"

Variant Events: 74

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ARL4A     2-0305-003chr7:
13585516-13585516
GGTATTCTTATGTGTTATATGTGTATTCTTATGTGTGAintergenicDe novo--Yuen2017 G
ARL4A     AU2215302chr7:
13247729-13247729
AGintergenicDe novo--Yuen2017 G
ARL4A     2-1342-003chr7:
13507982-13507982
GAintergenicDe novo--Yuen2017 G
ARL4A     2-0295-003chr7:
12841154-12841154
CGintergenicDe novo--Yuen2017 G
ARL4A     1-0978-003chr7:
13060198-13060198
CTintergenicDe novo--Yuen2017 G
ARL4A     2-1166-003chr7:
13567628-13567628
CAintergenicDe novo--Yuen2017 G
ARL4A     AU3638302chr7:
12937791-12937791
CAintergenicDe novo--Yuen2017 G
ARL4A     AU2215302chr7:
13302622-13302622
GCintergenicDe novo--Yuen2017 G
ARL4A     2-1277-003chr7:
13827589-13827589
AGintergenicDe novo--Yuen2017 G
ARL4A     AU2215302chr7:
13304692-13304692
TCintergenicDe novo--Yuen2017 G
ARL4A     1-0683-004chr7:
13338348-13338348
GAintergenicDe novo--Yuen2017 G
ARL4A     2-0300-003chr7:
13359782-13359782
TAintergenicDe novo--Yuen2017 G
ARL4A     2-1107-003chr7:
13194483-13194483
CTintergenicDe novo--Yuen2017 G
ARL4A     2-1719-003chr7:
13906788-13906788
GAintergenicDe novo--Yuen2017 G
ARL4A     AU2000304chr7:
13748450-13748450
CTintergenicDe novo--Yuen2017 G
ARL4A     AU3649305chr7:
12834788-12834788
CGintergenicDe novo--Yuen2017 G
ARL4A     2-0011-004chr7:
13918964-13918964
ATintergenicDe novo--Yuen2017 G
ARL4A     1-0406-003chr7:
13153172-13153172
TCintergenicDe novo--Yuen2017 G
ARL4A     2-1645-003chr7:
13065431-13065431
AGintergenicDe novo--Yuen2017 G
ARL4A     1-0113-003chr7:
13536165-13536165
CAintergenicDe novo--Yuen2016 G
ARL4A     AU4359301chr7:
13928249-13928249
GAintergenicDe novo--Yuen2017 G
ARL4A     AU4129303chr7:
13116534-13116535
ATAintergenicDe novo--Yuen2017 G
ARL4A     2-1146-003chr7:
13843986-13843986
CGintergenicDe novo--Yuen2017 G
ARL4A     AU4235301chr7:
13153725-13153725
GAintergenicDe novo--Yuen2017 G
ARL4A     2-1146-003chr7:
13843690-13843690
CGintergenicDe novo--Yuen2017 G
ARL4A     2-1146-003chr7:
13842134-13842134
CGintergenicDe novo--Yuen2017 G
ARL4A     AU2075301chr7:
12758919-12758919
GTintergenicDe novo--Yuen2017 G
ARL4A     2-1146-003chr7:
13841743-13841743
TGintergenicDe novo--Yuen2017 G
ARL4A     2-1146-003chr7:
13853412-13853412
CGintergenicDe novo--Yuen2017 G
ARL4A     2-1146-003chr7:
13846151-13846151
CTintergenicDe novo--Yuen2017 G
ARL4A     7-0058-003chr7:
13690400-13690402
CTGCintergenicDe novo--Yuen2017 G
ARL4A     2-1146-003chr7:
13844164-13844164
CGintergenicDe novo--Yuen2017 G
ARL4A     AU3790301chr7:
13882914-13882914
CTintergenicDe novo--Yuen2017 G
ARL4A     1-0571-003chr7:
13924440-13924440
CAintergenicDe novo--Yuen2017 G
ARL4A     AU4015301chr7:
13922101-13922101
GAintergenicDe novo--Yuen2017 G
ARL4A     2-1549-003chr7:
13273498-13273498
TCintergenicDe novo--Yuen2017 G
ARL4A     1-0004-003chr7:
13600884-13600884
GTintergenicDe novo--Yuen2017 G
ARL4A     1-0496-003chr7:
13501963-13501963
TGintergenicDe novo--Yuen2016 G
Yuen2017 G
ARL4A     AU3786301chr7:
13105344-13105344
AGintergenicDe novo--Yuen2017 G
ARL4A     1-0570-003chr7:
13311999-13311999
TCintergenicDe novo--Yuen2017 G
ARL4A     AU056003chr7:
13850243-13850243
GCintergenicDe novo--Yuen2017 G
ARL4A     13539.p1chr7:
13064985-13064985
TCintergenicDe novo--Turner2016 G
ARL4A     13946.p1chr7:
12845596-12845596
GAintergenicDe novo--Turner2016 G
ARL4A     1-0269-005chr7:
13548715-13548715
GAintergenicDe novo--Yuen2017 G
ARL4A     13946.p1chr7:
12845603-12845603
AGintergenicDe novo--Turner2016 G
ARL4A     1-0757-003chr7:
12998282-12998282
TCintergenicDe novo--Yuen2017 G
ARL4A     AU058105chr7:
13665521-13665521
CAintergenicDe novo--Yuen2017 G
ARL4A     1-0289-003chr7:
13420132-13420132
CAintergenicDe novo--Yuen2017 G
ARL4A     AU0638302chr7:
13128780-13128780
CTintergenicDe novo--Yuen2017 G
ARL4A     7-0219-003chr7:
13640170-13640170
CTintergenicDe novo--Yuen2017 G
ARL4A     1-0555-003chr7:
13599793-13599793
GAintergenicDe novo--Yuen2017 G
ARL4A     1-0555-003chr7:
13139487-13139487
AATTATAGTCAATTTTGAAGCAAAAGAGATTTCAGTCTTAGTintergenicDe novo--Yuen2017 G
ARL4A     2-1166-003chr7:
12907267-12907267
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
ARL4A     AU3761301chr7:
12965296-12965296
CGintergenicDe novo--Yuen2017 G
ARL4A     AU4435301chr7:
12906264-12906264
AGintergenicDe novo--Yuen2017 G
ARL4A     1-0384-003chr7:
13389386-13389386
AGintergenicDe novo--Yuen2017 G
ARL4A     AU3698301chr7:
13462610-13462616
ATAAGTAATAintergenicDe novo--Yuen2017 G
ARL4A     2-0210-004chr7:
13030328-13030328
CGintergenicDe novo--Yuen2017 G
ARL4A     3-0307-000chr7:
13340849-13340849
GTintergenicDe novo--Yuen2017 G
ARL4A     AU3761301chr7:
12966129-12966129
AGintergenicDe novo--Yuen2017 G
ARL4A     2-1437-004chr7:
13269993-13269993
CTintergenicDe novo--Yuen2017 G
ARL4A     AU3761301chr7:
12973739-12973739
ACintergenicDe novo--Yuen2017 G
ARL4A     3-0307-000chr7:
13336440-13336440
GCintergenicDe novo--Yuen2017 G
ARL4A     AU3768302chr7:
13790873-13790873
TCintergenicDe novo--Yuen2017 G
ARL4A     1-0232-004chr7:
13585516-13585516
GGTATTCTTATGTGTTATATGTGTATTCTTATGTGTGAintergenicDe novo--Yuen2017 G
ARL4A     1-0652-003chr7:
13871587-13871587
CAintergenicDe novo--Yuen2017 G
ARL4A     2-0057-004chr7:
12903218-12903218
GTintergenicDe novo--Yuen2017 G
ARL4A     2-1505-003chr7:
13334895-13334895
GGAGCCACCATGCCintergenicDe novo--Yuen2017 G
ARL4A     1-0991-003chr7:
13890357-13890357
GCintergenicDe novo--Yuen2017 G
ARL4A     AU4056302chr7:
13433140-13433141
CACAAintergenicDe novo--Yuen2017 G
ARL4A     AU2162302chr7:
13744793-13744793
TCintergenicDe novo--Yuen2017 G
ARL4A     AU4211304chr7:
13401605-13401611
ATATTATATATintergenicDe novo--Yuen2017 G
ARL4A     2-0006-003chr7:
12774534-12774534
TCintergenicDe novo--Yuen2017 G
ARL4A     2-1283-003chr7:
12884344-12884344
GGTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More