Variant Results

or

or

Results for "AFG3L2"

Variant Events: 9

Gene Gene symbol on which the variant is located	ID Subject Identifier from the original study	Location Genomic location of the reference allele	REF Reference allele	ALT Alternate allele	Context Variant functional categories	Variant validation performed by an orthogonal method and reported	Inheritance Reported inheritance status	Effects Variant effect on transcript per Annovar	Transcript Transcript used for the cDNA/Protein mutation	cDNA cDNA variant notation	Protein Protein variant notation	CADD-Phred v1.0 CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores	ExAC v0.3 ExAC population frequency (version 0.3)	Sources Source(s) where variants from this event are reported
AFG3L2	2-1180-003	chr18: 12390817-12390830	CTGTGTGTGTGTGT	CTGTGTGTGTGT	intergenic		De novo					-	-	Yuen2017 G
AFG3L2	mAGRE3114	chr18: 12371603-12371603	G	A	exonic		Maternal	stopgain	NM_006796	c.C202T	p.R68X	36.0	2.481E-5	Cirnigliaro2023 G
AFG3L2	Mahjani2021:12	chr18: 12358730-12358730	T	A	exonic			nonsynonymous SNV	NM_006796	c.A965T	p.E322V	26.8	-	Mahjani2021 E
AFG3L2	1-0493-003	chr18: 12334890-12334890	T	G	intronic		De novo					-	-	Trost2022 G Yuen2016 G Yuen2017 G
AFG3L2	mAGRE3116	chr18: 12371603-12371603	G	A	exonic		Maternal	stopgain	NM_006796	c.C202T	p.R68X	36.0	2.481E-5	Cirnigliaro2023 G
AFG3L2	1-0338-003	chr18: 12392495-12392495	C	G	intergenic		De novo					-	-	Yuen2017 G
AFG3L2	iHART3116	chr18: 12371603-12371603	G	A	exonic		Maternal	stopgain	NM_006796	c.C202T	p.R68X	36.0	2.481E-5	Ruzzo2019 G
AFG3L2	SP0139169	chr18: 12329784-12329784	T	TTCTCCACGTCAGCTTTCTTTTCTGTGAGAAGA	splicing		De novo	splicing				-	-	Fu2022 E
AFG3L2	iHART3114	chr18: 12371603-12371603	G	A	exonic		Maternal	stopgain	NM_006796	c.C202T	p.R68X	36.0	2.481E-5	Ruzzo2019 G

Source Variant Information

, -

Source:

Paper alias:

No records found.

Paper Information

Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count	The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notes	View
	More