or
or
Exact

Results for "MUC16"

Variant Events: 69

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
MUC16     1-0570-003chr19:
9159161-9159161
TCintergenicDe novo--Yuen2017 G
MUC16     JASD_Fam0024chr19:
8976388-8976388
GGTGCexonicDe novononframeshift insertionNM_024690c.42439_42440insGCAp.T14147delinsST--Takata2018 E
MUC16     AU231Achr19:
9038453-9038453
TCintronicDe novo--Satterstrom2020 E
MUC16     SP0126819chr19:
9062075-9062075
CTexonicDe novosynonymous SNVNM_024690c.G25371Ap.R8457R-8.286E-6Fu2022 E
MUC16     SP0115123chr19:
9087241-9087241
CTexonicDe novononsynonymous SNVNM_024690c.G4574Ap.S1525N1.623-Fu2022 E
MUC16     SP0042459chr19:
8966826-8966826
GAintronicDe novo--Fu2022 E
MUC16     2-1632-003chr19:
9061712-9061712
TCexonicDe novosynonymous SNVNM_024690c.A25734Gp.T8578T--Yuen2017 G
MUC16     SP0058138chr19:
9077030-9077030
TCexonicDe novosynonymous SNVNM_024690c.A10416Gp.T3472T--Fu2022 E
MUC16     SP0098809chr19:
9045912-9045912
TCexonicDe novononsynonymous SNVNM_024690c.A35719Gp.I11907V6.2998.287E-6Fu2022 E
MUC16     SP0004319chr19:
9000488-9000488
GTexonicDe novononsynonymous SNVNM_024690c.C40496Ap.P13499H11.94-Fu2022 E
MUC16     G01-GEA-73-HIchr19:
9016949-9016950
CACintronicDe novo--Satterstrom2020 E
MUC16     SP0080453chr19:
9076735-9076735
CGexonicDe novononsynonymous SNVNM_024690c.G10711Cp.E3571Q2.094-Fu2022 E
MUC16     SP0102270chr19:
9072050-9072050
GTexonicDe novononsynonymous SNVNM_024690c.C15396Ap.N5132K1.997-Fu2022 E
MUC16     1-0354-003chr19:
9177696-9177696
AAGintergenicDe novo--Yuen2017 G
MUC16     SP0007121chr19:
9019279-9019279
GAexonicDe novosynonymous SNVNM_024690c.C37608Tp.P12536P-8.361E-5Fu2022 E
MUC16     SP0065978chr19:
8998805-8998805
ACintronicDe novo--Fu2022 E
MUC16     SP0045624chr19:
8966908-8966908
CCAGGintronicDe novo--Fu2022 E
MUC16     2-0503-003chr19:
9177469-9177469
AAGintergenicDe novo--Yuen2017 G
MUC16     SP0011998chr19:
9017071-9017071
GAintronicDe novo--Fu2022 E
MUC16     SP0010081chr19:
8962089-8962089
GAintronicDe novo--Fu2022 E
MUC16     EGAN00001101153chr19:
9063533-9063533
GTexonicDe novosynonymous SNVNM_024690c.C23913Ap.S7971S--Fu2022 E
Satterstrom2020 E
MUC16     iHART2410chr19:
9005197-9005198
TGTexonicPaternalframeshift deletionNM_024690c.39879delCp.T13293fs--Ruzzo2019 G
MUC16     AU003403chr19:
9071897-9071897
CTexonicDe novosynonymous SNVNM_024690c.G15549Ap.E5183E--Yuen2017 G
MUC16     1-0224-004chr19:
9007084-9007084
GCintronicDe novo--Yuen2017 G
MUC16     iHART1752chr19:
9061269-9061271
CTTCexonicMaternalframeshift deletionNM_024690c.26175_26176delp.R8725fs--Ruzzo2019 G
MUC16     iHART1751chr19:
9061269-9061271
CTTCexonicMaternalframeshift deletionNM_024690c.26175_26176delp.R8725fs--Ruzzo2019 G
MUC16     iHART2656chr19:
9061533-9061537
TTCTCTexonicPaternalframeshift deletionNM_024690c.25909_25912delp.E8637fs--Ruzzo2019 G
MUC16     1-0395-004chr19:
9177696-9177696
AAGintergenicDe novo--Yuen2017 G
MUC16     iHART1754chr19:
9061269-9061271
CTTCexonicMaternalframeshift deletionNM_024690c.26175_26176delp.R8725fs--Ruzzo2019 G
MUC16     iHART2412chr19:
9005197-9005198
TGTexonicPaternalframeshift deletionNM_024690c.39879delCp.T13293fs--Ruzzo2019 G
MUC16     iHART2411chr19:
9005197-9005198
TGTexonicPaternalframeshift deletionNM_024690c.39879delCp.T13293fs--Ruzzo2019 G
MUC16     iHART3177chr19:
9049777-9049778
GAGexonicMaternalframeshift deletionNM_024690c.31853delTp.F10618fs--Ruzzo2019 G
MUC16     iHART2591chr19:
9049518-9049518
CAexonicMaternalstopgainNM_024690c.G32113Tp.E10705X60.0-Ruzzo2019 G
MUC16     AU1521301chr19:
9127720-9127727
GCCACCACGCCACintergenicDe novo--Yuen2017 G
MUC16     1-0593-003chr19:
9163013-9163027
TTATATATATATATATTATATATATATAintergenicDe novo--Yuen2017 G
MUC16     iHART2624chr19:
9087829-9087830
TCTexonicMaternalframeshift deletionNM_024690c.3985delGp.D1329fs-1.656E-5Ruzzo2019 G
MUC16     iHART2687chr19:
9066613-9066615
ACTAexonicMaternalframeshift deletionNM_024690c.20831_20832delp.E6944fs--Ruzzo2019 G
MUC16     iHART2303chr19:
9089941-9089942
TGTexonicMaternalframeshift deletionNM_024690c.1873delCp.H625fs-1.0E-4Ruzzo2019 G
MUC16     iHART2623chr19:
9087829-9087830
TCTexonicMaternalframeshift deletionNM_024690c.3985delGp.D1329fs-1.656E-5Ruzzo2019 G
MUC16     1-0579-003chr19:
9013256-9013271
ACATCATCATCATCATACATCATCATCATintronicDe novo--Yuen2017 G
MUC16     2-1174-005Bchr19:
9007096-9007096
ACintronicDe novo--Yuen2017 G
MUC16     SP0027722chr19:
9058886-9058886
CAexonicDe novosynonymous SNVNM_024690c.G28560Tp.A9520A-1.66E-5Feliciano2019 E
Fu2022 E
MUC16     A32chr19:
9186183-9186183
CAintergenicDe novo--Wu2018 G
MUC16     09C97625chr19:
9067023-9067025
GAAGexonicDe novoframeshift deletionNM_024690c.20421_20422delp.P6807fs-1.0E-4Satterstrom2020 E
MUC16     35890chr19:
9084772-9084772
GCexonicDe novononsynonymous SNVNM_024690c.C7043Gp.T2348R1.392-Fu2022 E
MUC16     1729001chr19:
9077729-9077729
CAexonicDe novononsynonymous SNVNM_024690c.G9717Tp.E3239D6.2188.281E-6Fu2022 E
MUC16     NP134chr19:
8976388-8976388
GGTGCexonicDe novononframeshift insertionNM_024690c.42439_42440insGCAp.T14147delinsST--Fu2022 E
MUC16     1-0539-003chr19:
9179035-9179035
TCintergenicDe novo--Yuen2017 G
MUC16     14239_p1chr19:
9062572-9062572
CTexonicDe novononsynonymous SNVNM_024690c.G24874Ap.A8292T5.5271.657E-5Fu2022 E
MUC16     2-1205-003chr19:
9190901-9190901
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
MUC16     F10174-1chr19:
8973574-8973574
GAexonicDe novononsynonymous SNVNM_024690c.C42742Tp.R14248C8.0963.081E-5Fu2022 E
MUC16     1-0559-003chr19:
9199297-9199297
CTintergenicDe novo--Yuen2017 G
MUC16     5422chr19:
9074510-9074510
TAexonicDe novononsynonymous SNVNM_024690c.A12936Tp.R4312S0.582-Fu2022 E
MUC16     ASC_9013chr19:
9066189-9066189
CAexonicDe novononsynonymous SNVNM_024690c.G21257Tp.S7086I3.12-Fu2022 E
MUC16     SSC10197chr19:
9061798-9061798
GAexonicDe novononsynonymous SNVNM_024690c.C25648Tp.P8550S1.961-Fu2022 E
Lim2017 E
MUC16     Lim2017:35890chr19:
9084772-9084772
GCexonicDe novononsynonymous SNVNM_024690c.C7043Gp.T2348R1.392-Lim2017 E
MUC16     Lim2017:5422chr19:
9074510-9074510
TAexonicDe novononsynonymous SNVNM_024690c.A12936Tp.R4312S0.582-Lim2017 E
MUC16     AU2863303chr19:
9112051-9112051
CTintergenicDe novo--Yuen2017 G
MUC16     7-0133-003chr19:
9158030-9158030
TGintergenicDe novo--Yuen2017 G
MUC16     13980.p1chr19:
9061798-9061798
GAexonicDe novononsynonymous SNVNM_024690c.C25648Tp.P8550S1.961-Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
MUC16     14239.p1chr19:
9062572-9062572
CTexonicDe novononsynonymous SNVNM_024690c.G24874Ap.A8292T5.5271.657E-5Iossifov2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
MUC16     11545.p1chr19:
9074510-9074510
TAexonicDe novononsynonymous SNVNM_024690c.A12936Tp.R4312S0.582-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
O’Roak2012b E
Satterstrom2020 E
Wilfert2021 G
MUC16     1-0382-003chr19:
9007148-9007148
CCGTCATCATAATCATCATAAACAGCAintronicDe novo--Yuen2017 G
MUC16     11868.p1chr19:
9084772-9084772
GCexonicDe novononsynonymous SNVNM_024690c.C7043Gp.T2348R1.392-Iossifov2014 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
Wilfert2021 G
MUC16     1-0338-005chr19:
9177469-9177469
AAGintergenicDe novo--Yuen2017 G
MUC16     SP0041539chr19:
9075330-9075330
CAexonicDe novononsynonymous SNVNM_024690c.G12116Tp.G4039V4.159-Feliciano2019 E
Fu2022 E
MUC16     5-0083-003chr19:
9116075-9116075
AGintergenicDe novo--Yuen2017 G
MUC16     9190736chr19:
9091529-9091529
GTexonicDe novononsynonymous SNVNM_024690c.C286Ap.H96N1.715-Fu2022 E
MUC16     14110.p1chr19:
9005515-9005515
CGintronicDe novo-5.019E-5Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More