or
or
Exact

Results for "THSD7B"

Variant Events: 61

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
THSD7B     SP0077788chr2:
138000068-138000068
TGexonicDe novononsynonymous SNVNM_001316349c.T2192Gp.F731C11.79-Fu2022 E
THSD7B     AU3636301chr2:
138436631-138436643
TACTAACTAACTATACTAACTAintergenicDe novo--Yuen2017 G
THSD7B     1-0508-003chr2:
138174627-138174627
TCintronicDe novo--Yuen2017 G
THSD7B     AU066403chr2:
138047742-138047742
AGintronicDe novo--Yuen2017 G
THSD7B     AU1542303chr2:
138096442-138096442
GAintronicDe novo--Yuen2017 G
THSD7B     JASD_Fam0244chr2:
138375981-138375981
GAexonicDe novosynonymous SNVNM_001316349c.G3585Ap.L1195L--Takata2018 E
THSD7B     1-0493-003chr2:
137699985-137699985
CTintronicDe novo--Yuen2017 G
THSD7B     1-0494-003Achr2:
138188229-138188229
GAintronicDe novo--Yuen2017 G
THSD7B     AU4069301chr2:
138194211-138194211
AGintronicDe novo--Yuen2017 G
THSD7B     1-0494-003Achr2:
137706828-137706828
AGintronicDe novo--Yuen2017 G
THSD7B     1-0936-003chr2:
138460276-138460276
CAintergenicDe novo--Yuen2017 G
THSD7B     1-0210-004chr2:
138174583-138174583
TGintronicDe novo--Yuen2017 G
THSD7B     7-0222-003chr2:
137835733-137835733
CGintronicDe novo--Yuen2017 G
THSD7B     1-0022-003chr2:
138050791-138050791
CTintronicDe novo--Yuen2016 G
THSD7B     1-0325-003chr2:
138086442-138086442
CAintronicDe novo--Yuen2017 G
THSD7B     2-1094-005chr2:
137560486-137560486
CTintronicDe novo--Yuen2017 G
THSD7B     AU2569303chr2:
137681118-137681118
GAintronicDe novo--Yuen2017 G
THSD7B     AU2569303chr2:
137891750-137891750
GAintronicDe novo--Yuen2017 G
THSD7B     1-0530-003chr2:
137730100-137730101
ATAintronicDe novo--Yuen2016 G
THSD7B     12498.p1chr2:
138198997-138198997
TGintronicDe novo--Turner2016 G
THSD7B     1-0459-003chr2:
138127636-138127636
CTintronicDe novo--Yuen2017 G
THSD7B     1-0206-005chr2:
137838062-137838062
GAintronicDe novo--Yuen2017 G
THSD7B     AU039305chr2:
138234161-138234161
TCintronicDe novo--Yuen2017 G
THSD7B     1-0656-003chr2:
138227858-138227858
CGintronicDe novo--Yuen2017 G
THSD7B     A19chr2:
138565927-138565927
TCintergenicDe novo--Wu2018 G
THSD7B     3-0391-000chr2:
138479410-138479410
ACintergenicDe novo--Yuen2017 G
THSD7B     1587021chr2:
138413259-138413259
TGintronicDe novo-9.903E-6Satterstrom2020 E
THSD7B     1-0494-003chr2:
137706828-137706828
AGintronicDe novo--Yuen2017 G
THSD7B     2-1381-003chr2:
138476835-138476835
TCintergenicDe novo--Yuen2017 G
THSD7B     2-1731-003chr2:
138382490-138382490
TCintronicDe novo--Yuen2017 G
THSD7B     2-1244-003chr2:
137534430-137534444
GCACACACACACACAGCACACACACACAintronicDe novo--Yuen2017 G
THSD7B     1-0570-003chr2:
137720599-137720610
ACATATCATATCACATATCintronicDe novo--Yuen2017 G
THSD7B     2-1246-003chr2:
138443472-138443474
GTCGintergenicDe novo--Yuen2017 G
THSD7B     1-0494-003chr2:
138188229-138188229
GAintronicDe novo--Yuen2017 G
THSD7B     1-0565-004chr2:
138505937-138505937
AGintergenicDe novo--Yuen2017 G
THSD7B     2-0289-004chr2:
138226273-138226273
TCintronicDe novo--Yuen2017 G
THSD7B     AU3866301chr2:
138497237-138497237
GAintergenicDe novo--Yuen2017 G
THSD7B     AU4153301chr2:
138361715-138361715
CAintronicDe novo--Yuen2017 G
THSD7B     AU3124302chr2:
138604746-138604746
TCintergenicDe novo--Yuen2017 G
THSD7B     AU2089301chr2:
138317680-138317680
GCintronicDe novo--Yuen2017 G
THSD7B     AU4231301chr2:
138224490-138224490
ACintronicDe novo--Yuen2017 G
THSD7B     AU3124302chr2:
138590331-138590331
TGintergenicDe novo--Yuen2017 G
THSD7B     1-0403-003chr2:
137890963-137890963
AGintronicDe novo--Yuen2017 G
THSD7B     AU3839303chr2:
138611541-138611541
CGintergenicDe novo--Yuen2017 G
THSD7B     AU4191302chr2:
138070140-138070140
GCintronicDe novo--Yuen2017 G
THSD7B     2-1735-003chr2:
137710207-137710207
GAintronicDe novo--Yuen2017 G
THSD7B     AU009805chr2:
138382251-138382251
TAintronicDe novo--Yuen2017 G
THSD7B     1-0022-004chr2:
138050791-138050791
CTintronicDe novo--Yuen2017 G
THSD7B     2-1215-003chr2:
137909782-137909782
CTintronicDe novo--Yuen2017 G
THSD7B     2-1342-003chr2:
137523536-137523536
GAintronicDe novo--Yuen2016 G
THSD7B     1-0006-004chr2:
138203917-138203917
CTintronicDe novo--Yuen2017 G
THSD7B     AU055004chr2:
138015512-138015512
CTintronicDe novo--Yuen2017 G
THSD7B     1-0330-004chr2:
137755735-137755735
AGintronicDe novo--Yuen2017 G
THSD7B     2-0149-003chr2:
137803101-137803101
AGintronicDe novo--Yuen2017 G
THSD7B     AU1933302chr2:
138267550-138267550
TCintronicDe novo--Yuen2017 G
THSD7B     2-1702-003chr2:
137762826-137762826
AGintronicDe novo--Yuen2017 G
THSD7B     2-1275-003chr2:
138077918-138077918
CAintronicDe novo--Yuen2017 G
THSD7B     AU4027306chr2:
138634737-138634737
CTintergenicDe novo--Yuen2017 G
THSD7B     iHART2290chr2:
138421145-138421145
GGGTGAexonicMaternalframeshift insertionNM_001316349c.4651_4652insGTGAp.D1551fs--Ruzzo2019 G
THSD7B     AU024607chr2:
138352125-138352125
GAintronicDe novo--Yuen2017 G
THSD7B     AU2410302chr2:
137990486-137990486
CTexonicDe novononsynonymous SNVNM_001316349c.C1933Tp.P645S0.384-Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More