or
or
Exact

Results for "ZBTB5"

Variant Events: 9

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ZBTB5     PN400195chr9:
37442167-37442167
GCexonicDe novononsynonymous SNVNM_014872c.C382Gp.P128A16.318.256E-6Leblond2019 E
ZBTB5     1-0265-004chr9:
37484073-37484073
TTCTTCTTTCTTCTTTCTTCATCintergenicDe novo--Yuen2017 G
ZBTB5     2-1261-004chr9:
37467210-37467210
CCTTAintergenicDe novo--Yuen2017 G
ZBTB5     2-1646-003chr9:
37467212-37467218
GTCTCTCGTCTCTCTCTCintergenicDe novo--Yuen2017 G
ZBTB5     1-0144-005chr9:
37438634-37438634
GAUTR3De novo--Yuen2017 G
ZBTB5     AU2793301chr9:
37448160-37448160
ATintronicDe novo--Yuen2017 G
ZBTB5     AU4467302chr9:
37479685-37479685
GAintergenicDe novo--Yuen2017 G
ZBTB5     A9chr9:
37482276-37482276
GAintergenicDe novo--Wu2018 G
ZBTB5     G01-GEA-14-HIchr9:
37441320-37441320
GAexonicDe novononsynonymous SNVNM_014872c.C1229Tp.S410L18.968.267E-6Lim2017 E
Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More