or
or
Exact

Results for "SH3RF1"

Variant Events: 24

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SH3RF1     2-0006-004chr4:
170065718-170065718
CTintronicDe novo--Yuen2017 G
SH3RF1     13956.p1chr4:
170077831-170077831
CCCTCACTGGGGGGCTCCAGGATTGCACCCGAGGCTGCTGTCCGCCCTGGGAGCTCTGCAGAsplicingDe novosplicing--Satterstrom2020 E
SH3RF1     AU3605304chr4:
170101458-170101458
CTintronicDe novo--Yuen2017 G
SH3RF1     AU3912303chr4:
170063766-170063766
AGintronicDe novo--Yuen2017 G
SH3RF1     AU4237301chr4:
170132185-170132185
CTintronicDe novo--Yuen2017 G
SH3RF1     2-0319-004chr4:
170152144-170152149
TGTGAGTintronicDe novo--Yuen2017 G
SH3RF1     2-1292-004chr4:
170266485-170266485
GAintergenicDe novo--Yuen2017 G
SH3RF1     AU4237304chr4:
170132185-170132185
CTintronicDe novo--Yuen2017 G
SH3RF1     AU1223303chr4:
170098306-170098306
TCintronicDe novo--Yuen2017 G
SH3RF1     AU056005chr4:
170140782-170140783
TGTintronicDe novo--Yuen2017 G
SH3RF1     1-0244-003chr4:
170045195-170045195
TCintronicDe novo--Yuen2017 G
SH3RF1     1-0206-004chr4:
170093917-170093917
CTintronicDe novo--Yuen2017 G
SH3RF1     2-1093-005chr4:
170279854-170279854
GTintergenicDe novo--Yuen2017 G
SH3RF1     2-1526-004chr4:
170141807-170141808
GCGintronicDe novo--Yuen2017 G
SH3RF1     2-1430-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
SH3RF1     5-0109-003chr4:
170089063-170089073
GGATATCTTGAGGATATCTTGATATCTTGAintronicDe novo--Yuen2017 G
SH3RF1     AU4029302chr4:
170163410-170163410
CTintronicDe novo--Yuen2017 G
SH3RF1     AU4235302chr4:
170085624-170085624
CTintronicDe novo--Yuen2017 G
SH3RF1     2-1511-003chr4:
170229367-170229367
ATintergenicDe novo--Yuen2017 G
SH3RF1     AU4176302chr4:
170143481-170143481
TCintronicDe novo--Yuen2017 G
SH3RF1     2-0002-005chr4:
170218557-170218561
ATTTTATTTTTintergenicDe novo--Yuen2017 G
SH3RF1     PN400512chr4:
170028218-170028218
CTexonicDe novononsynonymous SNVNM_020870c.G2278Ap.E760K17.278.413E-6Leblond2019 E
SH3RF1     2-1328-003chr4:
170054800-170054800
CTintronicDe novo--Yuen2017 G
SH3RF1     2K784chr4:
170028356-170028356
TTTTTGCTATCCTTGTCTGGTTTGGTTGCTGAACTGTTCCCACAAGCTGATGAAGCACTGTCAGGAGATGTGGGGAGTCCAGGGAGAACGGTCACTATCCGGCCACTGGGCTCAGCexonicDe novononframeshift insertionNM_020870c.2139_2140insGCTGAGCCCAGTGGCCGGATAGTGACCGTTCTCCCTGGACTCCCCACATCTCCTGACAGTGCTTCATCAGCTTGTGGGAACAGTTCAGCAACCAAACCAGACAAGGATAGCAAAp.K714delinsAEPSGRIVTVLPGLPTSPDSASSACGNSSATKPDKDSKK--Satterstrom2020 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More