or
or
Exact

Results for "PLA2G4A"

Variant Events: 17

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PLA2G4A     1-0403-004chr1:
186987747-186987747
TAintergenicDe novo--Yuen2017 G
PLA2G4A     1-0469-003chr1:
186918414-186918414
GGAAAAGAAAGAAAGAAAGAAAAAAintronicDe novo--Yuen2017 G
PLA2G4A     2-0144-003chr1:
186928190-186928190
TCintronicDe novo--Yuen2017 G
PLA2G4A     AU4327303chr1:
186999042-186999048
GAAAAAAGAAAAAAAintergenicDe novo--Yuen2017 G
PLA2G4A     AU066818chr1:
186890859-186890859
TCintronicDe novo--Yuen2017 G
PLA2G4A     2-0256-004chr1:
186899746-186899746
TCintronicDe novo--Yuen2017 G
PLA2G4A     AU4153301chr1:
186885379-186885385
CTTTTTTCTTTTTTTintronicDe novo--Yuen2017 G
PLA2G4A     1-0144-004chr1:
186839995-186839995
GAintronicDe novo--Yuen2017 G
PLA2G4A     2-1264-003chr1:
186899203-186899217
TGAGAGAGAGAGAGATGAGAGAGAGAGAintronicDe novo--Yuen2017 G
PLA2G4A     PN400102chr1:
186925350-186925350
CTexonicDe novononsynonymous SNVNM_001311193
NM_024420
c.C1273T
c.C1453T
p.R425C
p.R485C
19.22-Leblond2019 E
PLA2G4A     2-0016-003chr1:
187006853-187006853
GTintergenicDe novo--Yuen2017 G
PLA2G4A     2-1402-003chr1:
187035226-187035226
GTintergenicDe novo--Yuen2017 G
PLA2G4A     1-0286-004chr1:
186918426-186918426
GAintronicDe novo--Yuen2017 G
PLA2G4A     2-0036-003chr1:
187006853-187006853
GTintergenicDe novo--Yuen2016 G
PLA2G4A     1-0455-004chr1:
187060096-187060096
CTintergenicDe novo--Yuen2017 G
PLA2G4A     AU1521301chr1:
187043184-187043186
TGGTGintergenicDe novo--Yuen2017 G
PLA2G4A     3-0482-000chr1:
186851471-186851471
CAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More