or
or
Exact

Results for "ADNP"

Variant Events: 149

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ADNP     Zhang2023:ASD0134chr20:
49509095-49509095
TTTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.2156dupA
c.2156dupA
c.2156dupA
c.2156dupA
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
--Zhang2023 G
ADNP     GX0124.p1chr20:
49508141-49508141
TGexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A3110C
c.A3110C
c.A3110C
c.A3110C
p.E1037A
p.E1037A
p.E1037A
p.E1037A
12.49-Guo2018 T
ADNP     111294chr20:
49508751-49508755
CTTTACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2496_2499del
c.2496_2499del
c.2496_2499del
c.2496_2499del
p.N832fs
p.N832fs
p.N832fs
p.N832fs
--Helsmoortel2014 T
ADNP     M32301chr20:
49508073-49508073
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C3178T
c.C3178T
c.C3178T
c.C3178T
p.P1060S
p.P1060S
p.P1060S
p.P1060S
11.81-Guo2018 T
ADNP     035-09-110762chr20:
49508990-49508990
ACexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T2261G
c.T2261G
c.T2261G
c.T2261G
p.L754X
p.L754X
p.L754X
p.L754X
45.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ADNP     11-08612chr20:
49510040-49510040
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1211A
c.C1211A
c.C1211A
c.C1211A
p.S404X
p.S404X
p.S404X
p.S404X
40.0-Helsmoortel2014 T
ADNP     GX0471.p1chr20:
49509666-49509666
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G1585A
c.G1585A
c.G1585A
c.G1585A
p.A529T
p.A529T
p.A529T
p.A529T
15.971.648E-5Guo2018 T
ADNP     1050237chr20:
49509085-49509098
CATTTGCTCGTAAGCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2153_2165del
c.2153_2165del
c.2153_2165del
c.2153_2165del
p.T718fs
p.T718fs
p.T718fs
p.T718fs
--Helsmoortel2014 T
ADNP     M30841chr20:
49508520-49508520
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2731T
c.C2731T
c.C2731T
c.C2731T
p.H911Y
p.H911Y
p.H911Y
p.H911Y
4.5771.649E-5Guo2018 T
ADNP     3061-08Dchr20:
49509094-49509094
GCexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157G
c.C2157G
c.C2157G
c.C2157G
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Helsmoortel2014 T
ADNP     M12352chr20:
49508079-49508079
AGexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3172C
c.T3172C
c.T3172C
c.T3172C
p.S1058P
p.S1058P
p.S1058P
p.S1058P
5.8718.24E-6Wang2016 T
ADNP     122793chr20:
49508756-49508760
TTTAATexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2491_2494del
c.2491_2494del
c.2491_2494del
c.2491_2494del
p.L831fs
p.L831fs
p.L831fs
p.L831fs
--Helsmoortel2014 T
ADNP     07-06960chr20:
49508442-49508443
CGCexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.2808delC
c.2808delC
c.2808delC
c.2808delC
p.Y936X
p.Y936X
p.Y936X
p.Y936X
--Helsmoortel2014 T
ADNP     HN0125.p1chr20:
49507974-49507974
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3277A
c.G3277A
c.G3277A
c.G3277A
p.A1093T
p.A1093T
p.A1093T
p.A1093T
0.019-Guo2018 T
ADNP     2376chr20:
49508756-49508760
TTTAATexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2491_2494del
c.2491_2494del
c.2491_2494del
c.2491_2494del
p.L831fs
p.L831fs
p.L831fs
p.L831fs
--Helsmoortel2014 T
ADNP     2533chr20:
49509321-49509321
GAexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1930T
c.C1930T
c.C1930T
c.C1930T
p.R644X
p.R644X
p.R644X
p.R644X
42.0-Helsmoortel2014 T
ADNP     13545_p1chr20:
49509094-49509094
GGTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.2156dupA
c.2156dupA
c.2156dupA
c.2156dupA
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
--Fu2022 E
ADNP     13545.p1 Complex Event; expand row to view variants  De novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.2156dupA
c.2156dupA
c.2156dupA
c.2156dupA
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
--Helsmoortel2014 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2014 T
Satterstrom2020 E
Trost2022 G
Wang2020 T
Wilfert2021 G
Zhou2022 GE
ADNP     COL1111_03chr20:
49510027-49510029
CTTCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1222_1223del
c.1222_1223del
c.1222_1223del
c.1222_1223del
p.K408fs
p.K408fs
p.K408fs
p.K408fs
--Fu2022 E
ADNP     DEASD_2052_001chr20:
49509770-49509770
CTexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G1481A
c.G1481A
c.G1481A
c.G1481A
p.C494Y
p.C494Y
p.C494Y
p.C494Y
15.86-Fu2022 E
ADNP     GX0202.p1chr20:
49510928-49510928
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A323G
c.A323G
c.A323G
c.A323G
p.N108S
p.N108S
p.N108S
p.N108S
6.793-Guo2018 T
ADNP     M8878chr20:
49508151-49508151
CTexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3100A
c.G3100A
c.G3100A
c.G3100A
p.G1034R
p.G1034R
p.G1034R
p.G1034R
17.678.238E-5Wang2016 T
ADNP     GX0435.p1chr20:
49510592-49510592
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G659A
c.G659A
c.G659A
c.G659A
p.S220N
p.S220N
p.S220N
p.S220N
4.0132.471E-5Guo2018 T
ADNP     Gecz3_39914chr20:
49508203-49508203
CCTexonicUnknownframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.3047dupA
c.3047dupA
c.3047dupA
c.3047dupA
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016fs
-8.261E-6Wang2020 T
ADNP     ACGC_SX0083.p1chr20:
49510358-49510358
ACexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T893G
c.T893G
c.T893G
c.T893G
p.L298X
p.L298X
p.L298X
p.L298X
40.0-Wang2020 T
ADNP     ACGC_M01853chr20:
49508203-49508203
CCTexonicMaternalframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.3047dupA
c.3047dupA
c.3047dupA
c.3047dupA
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016fs
-8.261E-6Wang2020 T
ADNP     AGRE_AU019604chr20:
49508203-49508203
CCTexonicMaternalframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.3047dupA
c.3047dupA
c.3047dupA
c.3047dupA
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016fs
-8.261E-6Wang2020 T
ADNP     Leuven_56744chr20:
49518645-49518645
TAexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A110T
c.A110T
c.A110T
c.A110T
p.D37V
p.D37V
p.D37V
p.D37V
27.4-Wang2020 T
ADNP     ACGC_HEN0007.p1chr20:
49508932-49508932
CCTexonicUnknownframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2318dupA
c.2318dupA
c.2318dupA
c.2318dupA
p.K773fs
p.K773fs
p.K773fs
p.K773fs
--Wang2020 T
ADNP     ACGC_HN0024.p1chr20:
49509063-49509063
GAexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2188T
c.C2188T
c.C2188T
c.C2188T
p.R730X
p.R730X
p.R730X
p.R730X
41.0-Wang2020 T
ADNP     ACGC_GX0639.p1chr20:
49508869-49508869
CTexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.G2382A
c.G2382A
c.G2382A
c.G2382A
p.W794X
p.W794X
p.W794X
p.W794X
46.0-Wang2020 T
ADNP     SAGE_BK_720_01chr20:
49510431-49510432
TGTexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.819delC
c.819delC
c.819delC
c.819delC
p.P273fs
p.P273fs
p.P273fs
p.P273fs
--Wang2020 T
ADNP     AU4242302chr20:
49505407-49505407
CTdownstreamDe novo--Trost2022 G
Yuen2017 G
ADNP     SD0063.p1chr20:
49508024-49508024
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A3227G
c.A3227G
c.A3227G
c.A3227G
p.Q1076R
p.Q1076R
p.Q1076R
p.Q1076R
11.65-Guo2018 T
ADNP     SAGE_BK_683_01chr20:
49510149-49510149
GAexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1102T
c.C1102T
c.C1102T
c.C1102T
p.Q368X
p.Q368X
p.Q368X
p.Q368X
41.0-Wang2020 T
ADNP     SAGE_BK767-01chr20:
49518564-49518564
GGTexonicDe novoframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.190dupA
c.190dupA
c.190dupA
c.190dupA
p.T64fs
p.T64fs
p.T64fs
p.T64fs
--Wang2020 T
ADNP     ACGC_M27882chr20:
49510619-49510619
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T632A
c.T632A
c.T632A
c.T632A
p.L211X
p.L211X
p.L211X
p.L211X
39.0-Wang2020 T
ADNP     M15242chr20:
49507974-49507974
CTexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3277A
c.G3277A
c.G3277A
c.G3277A
p.A1093T
p.A1093T
p.A1093T
p.A1093T
0.019-Guo2018 T
Wang2016 T
ADNP     TASC_211-5367-3chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-Wang2020 T
ADNP     M01853 Complex Event; expand row to view variants  Maternalframeshift insertion, nonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
NM_001282532
NM_181442
NM_015339
NM_001282531
c.3047dupA
c.3047dupA
c.3047dupA
c.3047dupA
c.G3048C
c.G3048C
c.G3048C
c.G3048C
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016N
p.K1016N
p.K1016N
p.K1016N
11.658.261E-6Guo2018 T
Wang2016 T
ADNP     M27882chr20:
49510619-49510619
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T632A
c.T632A
c.T632A
c.T632A
p.L211X
p.L211X
p.L211X
p.L211X
39.0-Guo2018 T
Stessman2017 T
Wang2016 T
ADNP     HEN0265.p1chr20:
49510232-49510232
CAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G1019T
c.G1019T
c.G1019T
c.G1019T
p.G340V
p.G340V
p.G340V
p.G340V
8.1873.295E-5Guo2018 T
ADNP     mAGRE4099chr20:
49508203-49508203
CCTexonicMaternalframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.3047dupA
c.3047dupA
c.3047dupA
c.3047dupA
p.K1016fs
p.K1016fs
p.K1016fs
p.K1016fs
-8.261E-6Cirnigliaro2023 G
ADNP     GX0558.p1chr20:
49509029-49509029
ACexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T2222G
c.T2222G
c.T2222G
c.T2222G
p.F741C
p.F741C
p.F741C
p.F741C
12.21-Guo2018 T
ADNP     HEN0250.p1chr20:
49511018-49511018
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C233T
c.C233T
c.C233T
c.C233T
p.A78V
p.A78V
p.A78V
p.A78V
12.738.454E-6Guo2018 T
ADNP     SP0130990chr20:
49510708-49510712
CCTAACexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.539_542del
c.539_542del
c.539_542del
c.539_542del
p.V180fs
p.V180fs
p.V180fs
p.V180fs
--Zhou2022 GE
ADNP     SP0075687chr20:
49510708-49510712
CCTAACexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.539_542del
c.539_542del
c.539_542del
c.539_542del
p.V180fs
p.V180fs
p.V180fs
p.V180fs
--Zhou2022 GE
ADNP     SP0036637chr20:
49509716-49509716
ACexonicnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1535G
c.T1535G
c.T1535G
c.T1535G
p.L512R
p.L512R
p.L512R
p.L512R
17.32-Zhou2022 GE
ADNP     SP0042813chr20:
49509683-49509683
TGexonicnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A1568C
c.A1568C
c.A1568C
c.A1568C
p.D523A
p.D523A
p.D523A
p.D523A
17.1-Zhou2022 GE
ADNP     M16139chr20:
49510040-49510040
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1211T
c.C1211T
c.C1211T
c.C1211T
p.S404L
p.S404L
p.S404L
p.S404L
8.4788.238E-6Guo2018 T
Wang2016 T
ADNP     M15147chr20:
49508976-49508976
GAexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2275T
c.C2275T
c.C2275T
c.C2275T
p.H759Y
p.H759Y
p.H759Y
p.H759Y
7.644-Guo2018 T
Wang2016 T
ADNP     ASD-821chr20:
49520532-49520532
AGexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T2C
c.T2C
c.T2C
c.T2C
p.M1T
p.M1T
p.M1T
p.M1T
24.3-Du2018 E
ADNP     D’Gama2015:797chr20:
49507970-49507970
CAexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3281T
c.G3281T
c.G3281T
c.G3281T
p.G1094V
p.G1094V
p.G1094V
p.G1094V
16.38.633E-6D’Gama2015 T
ADNP     M30823chr20:
49509029-49509029
ACexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T2222G
c.T2222G
c.T2222G
c.T2222G
p.F741C
p.F741C
p.F741C
p.F741C
12.21-Guo2018 T
ADNP     GX0033.p1chr20:
49508505-49508505
TCexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A2746G
c.A2746G
c.A2746G
c.A2746G
p.I916V
p.I916V
p.I916V
p.I916V
0.578-Guo2018 T
ADNP     GX0091.p1chr20:
49508136-49508136
AGexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3115C
c.T3115C
c.T3115C
c.T3115C
p.F1039L
p.F1039L
p.F1039L
p.F1039L
13.95-Guo2018 T
ADNP     GX0403.p1chr20:
49508393-49508393
GAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2858T
c.C2858T
c.C2858T
c.C2858T
p.S953F
p.S953F
p.S953F
p.S953F
11.59-Guo2018 T
ADNP     GX0309.p1chr20:
49508318-49508318
GAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2933T
c.C2933T
c.C2933T
c.C2933T
p.S978F
p.S978F
p.S978F
p.S978F
17.38-Guo2018 T
ADNP     SD0087.p1chr20:
49509095-49509096
TATexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2155delT
c.2155delT
c.2155delT
c.2155delT
p.Y719fs
p.Y719fs
p.Y719fs
p.Y719fs
--Guo2018 T
ADNP     SP0131947chr20:
49510393-49510398
CCTTGGCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.853_857del
c.853_857del
c.853_857del
c.853_857del
p.P285fs
p.P285fs
p.P285fs
p.P285fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     SP0036574chr20:
49510203-49510205
CCACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1046_1047del
c.1046_1047del
c.1046_1047del
c.1046_1047del
p.L349fs
p.L349fs
p.L349fs
p.L349fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     SP0082696chr20:
49510916-49510916
CCTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.334_335insA
c.334_335insA
c.334_335insA
c.334_335insA
p.C112_T113delinsX
p.C112_T113delinsX
p.C112_T113delinsX
p.C112_T113delinsX
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     SP0104108chr20:
49510888-49510890
CAACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.361_362del
c.361_362del
c.361_362del
c.361_362del
p.L121fs
p.L121fs
p.L121fs
p.L121fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     SSC08311chr20:
49509094-49509094
GGTexonicstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.2156dupA
c.2156dupA
c.2156dupA
c.2156dupA
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
p.Y719_E720delinsX
--Antaki2022 GE
ADNP     SP0000938chr20:
49508963-49508964
GAGexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2287delT
c.2287delT
c.2287delT
c.2287delT
p.S763fs
p.S763fs
p.S763fs
p.S763fs
--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     SSC04121chr20:
49510027-49510029
CTTCexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1222_1223del
c.1222_1223del
c.1222_1223del
c.1222_1223del
p.K408fs
p.K408fs
p.K408fs
p.K408fs
--Antaki2022 GE
ADNP     SP0086863chr20:
49509094-49509094
GCexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157G
c.C2157G
c.C2157G
c.C2157G
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     AU024104chr20:
49537528-49537528
GAintronicDe novo--Trost2022 G
Yuen2017 G
ADNP     M27874chr20:
49510010-49510010
TAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A1241T
c.A1241T
c.A1241T
c.A1241T
p.Q414L
p.Q414L
p.Q414L
p.Q414L
14.171.648E-5Guo2018 T
Wang2016 T
ADNP     M8121chr20:
49507974-49507974
CTexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3277A
c.G3277A
c.G3277A
c.G3277A
p.A1093T
p.A1093T
p.A1093T
p.A1093T
0.019-Wang2016 T
ADNP     SP0001740chr20:
49508976-49509001
GACCCTTGGGGTCTAAAGCTAAAACAGexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2250_2274del
c.2250_2274del
c.2250_2274del
c.2250_2274del
p.V750fs
p.V750fs
p.V750fs
p.V750fs
--Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     Leuven2_62538053chr20:
49509963-49509963
CCAexonicUnknownframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1287dupT
c.1287dupT
c.1287dupT
c.1287dupT
p.A430fs
p.A430fs
p.A430fs
p.A430fs
--Wang2020 T
ADNP     Leuven2_85803369chr20:
49509847-49509849
TTCTexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1402_1403del
c.1402_1403del
c.1402_1403del
c.1402_1403del
p.E468fs
p.E468fs
p.E468fs
p.E468fs
--Wang2020 T
ADNP     08C76513chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ADNP     SAGE_BK_714_01chr20:
49508751-49508755
CTTTACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2496_2499del
c.2496_2499del
c.2496_2499del
c.2496_2499del
p.N832fs
p.N832fs
p.N832fs
p.N832fs
--Wang2020 T
ADNP     SAGE_566.03chr20:
49510911-49510912
AGAexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.339delC
c.339delC
c.339delC
c.339delC
p.T113fs
p.T113fs
p.T113fs
p.T113fs
--Wang2020 T
ADNP     SAGE_569.03chr20:
49510203-49510205
CCACexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1046_1047del
c.1046_1047del
c.1046_1047del
c.1046_1047del
p.L349fs
p.L349fs
p.L349fs
p.L349fs
--Wang2020 T
ADNP     12130.p1chr20:
49510027-49510029
CTTCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1222_1223del
c.1222_1223del
c.1222_1223del
c.1222_1223del
p.K408fs
p.K408fs
p.K408fs
p.K408fs
--Dong2014 E
Helsmoortel2014 T
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
O’Roak2012a T
O’Roak2012b E
O’Roak2014 T
Wang2020 T
Wilfert2021 G
Willsey2013 E
Zhou2022 GE
ADNP     1-0382-003chr20:
49507667-49507667
TCUTR3De novo--Trost2022 G
Yuen2017 G
ADNP     Naples_5941chr20:
49509094-49509094
GCexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157G
c.C2157G
c.C2157G
c.C2157G
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     SP0171168chr20:
49509657-49509657
GAexonicnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1594T
c.C1594T
c.C1594T
c.C1594T
p.R532W
p.R532W
p.R532W
p.R532W
14.86-Zhou2022 GE
ADNP     SP0197130chr20:
49509063-49509063
GAexonicstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2188T
c.C2188T
c.C2188T
c.C2188T
p.R730X
p.R730X
p.R730X
p.R730X
41.0-Zhou2022 GE
ADNP     SP0227282chr20:
49510536-49510536
GCexonicnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C715G
c.C715G
c.C715G
c.C715G
p.H239D
p.H239D
p.H239D
p.H239D
14.56-Zhou2022 GE
ADNP     12707.p1chr20:
49507972-49507972
GGGGexonicMaternalframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.3278_3279insCC
c.3278_3279insCC
c.3278_3279insCC
c.3278_3279insCC
p.A1093fs
p.A1093fs
p.A1093fs
p.A1093fs
--O’Roak2012a T
ADNP     M03533chr20:
49508963-49508963
GAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2288T
c.C2288T
c.C2288T
c.C2288T
p.S763F
p.S763F
p.S763F
p.S763F
31.0-Guo2018 T
Wang2016 T
ADNP     SP0196378chr20:
49510149-49510149
GAexonicstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C1102T
c.C1102T
c.C1102T
c.C1102T
p.Q368X
p.Q368X
p.Q368X
p.Q368X
41.0-Zhou2022 GE
ADNP     M16274chr20:
49508291-49508291
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A2960G
c.A2960G
c.A2960G
c.A2960G
p.N987S
p.N987S
p.N987S
p.N987S
11.081.648E-5Guo2018 T
Wang2016 T
ADNP     M15199chr20:
49508199-49508199
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A3052G
c.A3052G
c.A3052G
c.A3052G
p.T1018A
p.T1018A
p.T1018A
p.T1018A
0.1948.237E-6Guo2018 T
Wang2016 T
ADNP     M08121chr20:
49507974-49507974
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G3277A
c.G3277A
c.G3277A
c.G3277A
p.A1093T
p.A1093T
p.A1093T
p.A1093T
0.019-Guo2018 T
ADNP     SF0000938.p1chr20:
49508963-49508964
GAGexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2287delT
c.2287delT
c.2287delT
c.2287delT
p.S763fs
p.S763fs
p.S763fs
p.S763fs
--Wang2020 T
ADNP     M18390chr20:
49508283-49508283
CTexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G2968A
c.G2968A
c.G2968A
c.G2968A
p.E990K
p.E990K
p.E990K
p.E990K
15.847.414E-5Guo2018 T
Wang2016 T
ADNP     SAGE_TIGER_T204-03chr20:
49509094-49509094
GTexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     SAGE_BK755-01chr20:
49509094-49509094
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     SF0036637.p1chr20:
49509716-49509716
ACexonicnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1535G
c.T1535G
c.T1535G
c.T1535G
p.L512R
p.L512R
p.L512R
p.L512R
17.32-Wang2020 T
ADNP     SF0036637.p1chr20:
49509711-49509711
ACexonicnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1540G
c.T1540G
c.T1540G
c.T1540G
p.C514G
p.C514G
p.C514G
p.C514G
16.78-Wang2020 T
ADNP     08C73958chr20:
49510224-49510224
CCAexonicDe novoframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1026dupT
c.1026dupT
c.1026dupT
c.1026dupT
p.V343fs
p.V343fs
p.V343fs
p.V343fs
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ADNP     SF0131947.p1chr20:
49510393-49510398
CCTTGGCexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.853_857del
c.853_857del
c.853_857del
c.853_857del
p.P285fs
p.P285fs
p.P285fs
p.P285fs
--Wang2020 T
ADNP     SF0036574.p1chr20:
49510203-49510205
CCACexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1046_1047del
c.1046_1047del
c.1046_1047del
c.1046_1047del
p.L349fs
p.L349fs
p.L349fs
p.L349fs
--Wang2020 T
ADNP     M03713chr20:
49510033-49510033
CA/CexonicPaternal--Guo2018 T
ADNP     SF0041760.p1chr20:
49509094-49509094
GTexonicstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     M08083chr20:
49508708-49508708
TCexonicPaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A2543G
c.A2543G
c.A2543G
c.A2543G
p.N848S
p.N848S
p.N848S
p.N848S
16.12-Guo2018 T
ADNP     SF0086863.p1chr20:
49509094-49509094
GCexonicstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157G
c.C2157G
c.C2157G
c.C2157G
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     SF0042813.p1chr20:
49509683-49509683
TGexonicnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A1568C
c.A1568C
c.A1568C
c.A1568C
p.D523A
p.D523A
p.D523A
p.D523A
17.1-Wang2020 T
ADNP     SF0081420.p1chr20:
49509094-49509094
GTexonicstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Wang2020 T
ADNP     ACGC_M03533chr20:
49508963-49508963
GAexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2288T
c.C2288T
c.C2288T
c.C2288T
p.S763F
p.S763F
p.S763F
p.S763F
31.0-Wang2020 T
ADNP     SF0103630.p3chr20:
49510998-49510998
AGexonicnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T253C
c.T253C
c.T253C
c.T253C
p.F85L
p.F85L
p.F85L
p.F85L
14.19-Wang2020 T
ADNP     COL1111.03chr20:
49510027-49510029
CTTCexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1222_1223del
c.1222_1223del
c.1222_1223del
c.1222_1223del
p.K408fs
p.K408fs
p.K408fs
p.K408fs
--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ADNP     G01-GEA-207-HIchr20:
49508823-49508827
TCTTCTexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2424_2427del
c.2424_2427del
c.2424_2427del
c.2424_2427del
p.R808fs
p.R808fs
p.R808fs
p.R808fs
--Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ADNP     SF0130990.p1chr20:
49510708-49510712
CCTAACexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.539_542del
c.539_542del
c.539_542del
c.539_542del
p.V180fs
p.V180fs
p.V180fs
p.V180fs
--Wang2020 T
ADNP     SF0075687.p1chr20:
49510708-49510712
CCTAACexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.539_542del
c.539_542del
c.539_542del
c.539_542del
p.V180fs
p.V180fs
p.V180fs
p.V180fs
--Wang2020 T
ADNP     SF0082696.p1chr20:
49510916-49510916
CCTexonicstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.334_335insA
c.334_335insA
c.334_335insA
c.334_335insA
p.C112_T113delinsX
p.C112_T113delinsX
p.C112_T113delinsX
p.C112_T113delinsX
--Wang2020 T
ADNP     G01_GEA516HIchr20:
49508751-49508755
CTTTACexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2496_2499del
c.2496_2499del
c.2496_2499del
c.2496_2499del
p.N832fs
p.N832fs
p.N832fs
p.N832fs
--Fu2022 E
ADNP     M13413chr20:
49508156-49508156
GCexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.C3095G
c.C3095G
c.C3095G
c.C3095G
p.S1032C
p.S1032C
p.S1032C
p.S1032C
15.468.238E-5Wang2016 T
ADNP     SF0104108.p1chr20:
49510888-49510890
CAACexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.361_362del
c.361_362del
c.361_362del
c.361_362del
p.L121fs
p.L121fs
p.L121fs
p.L121fs
--Wang2020 T
ADNP     1-0353-003chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-Wang2020 T
Yuen2017 G
Zhou2022 GE
ADNP     M17485chr20:
49508436-49508436
TGexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A2815C
c.A2815C
c.A2815C
c.A2815C
p.I939L
p.I939L
p.I939L
p.I939L
0.1172.0E-4Wang2016 T
ADNP     IGM1648671chr20:
49510505-49510505
TCexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A746G
c.A746G
c.A746G
c.A746G
p.Y249C
p.Y249C
p.Y249C
p.Y249C
11.49-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ADNP     211-5367-3chr20:
49508081-49508081
ATexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3170A
c.T3170A
c.T3170A
c.T3170A
p.L1057X
p.L1057X
p.L1057X
p.L1057X
45.0-O’Roak2014 T
Stessman2017 T
Stessman2017 T
ADNP     1986-24087chr20:
49508452-49508453
ACAexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2798delG
c.2798delG
c.2798delG
c.2798delG
p.G933fs
p.G933fs
p.G933fs
p.G933fs
--Callaghan2019 G
ADNP     Krgovic2022:021055chr20:
49509063-49509063
GAexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2188T
c.C2188T
c.C2188T
c.C2188T
p.R730X
p.R730X
p.R730X
p.R730X
41.0-Krgovic2022 E
ADNP     2-0028-003 Complex Event; expand row to view variants  De novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
NM_001282532
NM_181442
NM_015339
NM_001282531
c.1035_1038del
c.1035_1038del
c.1035_1038del
c.1035_1038del
c.1031_1034del
c.1031_1034del
c.1031_1034del
c.1031_1034del
p.Q345fs
p.Q345fs
p.Q345fs
p.Q345fs
p.G344fs
p.G344fs
p.G344fs
p.G344fs
--Trost2022 G
Wang2020 T
Yuen2016 G
Yuen2017 G
Zhou2022 GE
ADNP     Alvarez-Mora2016:ASD-23chr20:
49509924-49509924
TCexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A1327G
c.A1327G
c.A1327G
c.A1327G
p.T443A
p.T443A
p.T443A
p.T443A
12.1-Alvarez-Mora2016 T
ADNP     Cherot2017:1chr20:
49510578-49510578
GAexonicUnknownstopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C673T
c.C673T
c.C673T
c.C673T
p.R225X
p.R225X
p.R225X
p.R225X
39.0-Cherot2017 E
ADNP     Krgovic2022:020213chr20:
49508755-49508759
ATTTAAexonicDe novoframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2492_2495del
c.2492_2495del
c.2492_2495del
c.2492_2495del
p.L831fs
p.L831fs
p.L831fs
p.L831fs
--Krgovic2022 E
ADNP     Krgovic2022:027819chr20:
49508182-49508184
TCTTexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.3067_3068del
c.3067_3068del
c.3067_3068del
c.3067_3068del
p.R1023fs
p.R1023fs
p.R1023fs
p.R1023fs
--Krgovic2022 E
ADNP     ASC_CA_75_Achr20:
49508963-49508963
GGAexonicDe novoframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2287dupT
c.2287dupT
c.2287dupT
c.2287dupT
p.S763fs
p.S763fs
p.S763fs
p.S763fs
--Satterstrom2020 E
Trost2022 G
Zhou2022 GE
ADNP     HEN0171.p1chr20:
49508283-49508283
CTexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G2968A
c.G2968A
c.G2968A
c.G2968A
p.E990K
p.E990K
p.E990K
p.E990K
15.847.414E-5Guo2018 T
ADNP     HEN0258.p1chr20:
49510164-49510164
ATexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1087A
c.T1087A
c.T1087A
c.T1087A
p.S363T
p.S363T
p.S363T
p.S363T
11.02-Guo2018 T
ADNP     SX0011.p1chr20:
49508442-49508442
CTexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G2809A
c.G2809A
c.G2809A
c.G2809A
p.E937K
p.E937K
p.E937K
p.E937K
0.4857.419E-5Guo2018 T
ADNP     Mahjani2021:95chr20:
49508932-49508934
CTTCexonicframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2317_2318del
c.2317_2318del
c.2317_2318del
c.2317_2318del
p.K773fs
p.K773fs
p.K773fs
p.K773fs
--Mahjani2021 E
ADNP     SP0041760chr20:
49509094-49509094
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     GX0536.p1chr20:
49510604-49510604
CTexonicMaternalnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.G647A
c.G647A
c.G647A
c.G647A
p.R216Q
p.R216Q
p.R216Q
p.R216Q
9.9748.238E-6Guo2018 T
ADNP     DEASD_0149_001chr20:
49508382-49508386
CCTCACexonicDe novo, Unknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2865_2868del
c.2865_2868del
c.2865_2868del
c.2865_2868del
p.S955fs
p.S955fs
p.S955fs
p.S955fs
--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
ADNP     DEASD_0076_001chr20:
49510602-49510610
CTCGGGCATCexonicDe novo, Unknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.641_648del
c.641_648del
c.641_648del
c.641_648del
p.N214fs
p.N214fs
p.N214fs
p.N214fs
--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
ADNP     SP0071775chr20:
49509334-49509334
AGexonicDe novosynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1917C
c.T1917C
c.T1917C
c.T1917C
p.L639L
p.L639L
p.L639L
p.L639L
--Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     SP0093864chr20:
49509094-49509094
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     SP0081420chr20:
49509094-49509094
GTexonicDe novostopgainNM_001282532
NM_181442
NM_015339
NM_001282531
c.C2157A
c.C2157A
c.C2157A
c.C2157A
p.Y719X
p.Y719X
p.Y719X
p.Y719X
38.0-Fu2022 E
Trost2022 G
Zhou2022 GE
ADNP     SP0103632chr20:
49510998-49510998
AGexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T253C
c.T253C
c.T253C
c.T253C
p.F85L
p.F85L
p.F85L
p.F85L
14.19-Fu2022 E
Zhou2022 GE
ADNP     213-8763-103chr20:
49510224-49510224
CCAexonicDe novoframeshift insertionNM_001282532
NM_181442
NM_015339
NM_001282531
c.1026dupT
c.1026dupT
c.1026dupT
c.1026dupT
p.V343fs
p.V343fs
p.V343fs
p.V343fs
--O’Roak2014 T
ADNP     SP0036637chr20:
49509711-49509711
ACexonicDe novononsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T1540G
c.T1540G
c.T1540G
c.T1540G
p.C514G
p.C514G
p.C514G
p.C514G
16.78-Fu2022 E
Zhou2022 GE
ADNP     1-0402-004chr20:
49521044-49521047
TGAGCGCGCintronicDe novo--Trost2022 G
ADNP     SP0230886chr20:
49510774-49510774
AGexonicDe novosynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T477C
c.T477C
c.T477C
c.T477C
p.S159S
p.S159S
p.S159S
p.S159S
--Trost2022 G
ADNP     56744chr20:
49518645-49518645
TAexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.A110T
c.A110T
c.A110T
c.A110T
p.D37V
p.D37V
p.D37V
p.D37V
27.4-Stessman2017 T
ADNP     SAGE_BK_673_01chr20:
49510963-49510964
GAGexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.287delT
c.287delT
c.287delT
c.287delT
p.V96fs
p.V96fs
p.V96fs
p.V96fs
--Wang2020 T
ADNP     ACGC_SD0087.p1chr20:
49509095-49509096
TATexonicUnknownframeshift deletionNM_001282532
NM_181442
NM_015339
NM_001282531
c.2155delT
c.2155delT
c.2155delT
c.2155delT
p.Y719fs
p.Y719fs
p.Y719fs
p.Y719fs
--Wang2020 T
ADNP     M8258chr20:
49508079-49508079
AGexonicUnknownnonsynonymous SNVNM_001282532
NM_181442
NM_015339
NM_001282531
c.T3172C
c.T3172C
c.T3172C
c.T3172C
p.S1058P
p.S1058P
p.S1058P
p.S1058P
5.8718.24E-6Wang2016 T
ADNP     1031chr20:
49542290-49542290
GTintronicDe novo--Trost2022 G
ADNP     D4S2Z-01chr20:
49529849-49529849
TAintronicDe novo--Trost2022 G
ADNP     2-1198-003chr20:
49526763-49526763
CCAintronicDe novo--Trost2022 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More