or
or
Exact

Results for "FNDC1"

Variant Events: 18

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
FNDC1     1-0458-005chr6:
159660857-159660857
AGexonicDe novononsynonymous SNVNM_032532c.A4489Gp.T1497A10.34-Yuen2015 G
Yuen2017 G
FNDC1     09C83881chr6:
159655488-159655488
CAexonicDe novononsynonymous SNVNM_032532c.C3944Ap.P1315H12.41-Satterstrom2020 E
FNDC1     5-0084-003chr6:
159786530-159786530
GAintergenicDe novo--Yuen2017 G
FNDC1     7-0256-003chr6:
159643981-159643981
CTintronicDe novo--Yuen2017 G
FNDC1     13940.p1chr6:
159670225-159670225
TCintronicDe novo--Krumm2015 E
Satterstrom2020 E
Werling2018 G
Wilfert2021 G
FNDC1     AU4372309chr6:
159787859-159787878
ATATGAACAGACACTTCTTAATAintergenicDe novo--Yuen2017 G
FNDC1     AU2109301chr6:
159608184-159608184
CTintronicDe novo--Yuen2017 G
FNDC1     2-1526-003chr6:
159720105-159720107
TACTintergenicDe novo--Yuen2017 G
FNDC1     1-0139-005chr6:
159605889-159605889
CTintronicDe novo--Yuen2017 G
FNDC1     1-0467-005chr6:
159757778-159757778
TCintergenicDe novo--Yuen2017 G
FNDC1     7-0024-005chr6:
159686985-159686985
AAACAAACAAACAAACAACAACintronicDe novo--Yuen2017 G
FNDC1     AU4356302chr6:
159689548-159689548
AGintronicDe novo--Yuen2017 G
FNDC1     2-1357-003chr6:
159739155-159739155
CAintergenicDe novo--Yuen2017 G
FNDC1     2-1644-003chr6:
159768460-159768460
TCintergenicDe novo--Yuen2017 G
FNDC1     AU3794301chr6:
159597699-159597699
AGintronicDe novo--Yuen2017 G
FNDC1     2-1365-003chr6:
159769994-159769994
TAintergenicDe novo--Yuen2016 G
Yuen2017 G
FNDC1     2-0286-003chr6:
159600410-159600410
GTintronicDe novo--Yuen2017 G
FNDC1     2-1342-003chr6:
159789762-159789762
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More