or
or
Exact

Results for "TNFAIP3"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TNFAIP3     AU1860301chr6:
138222178-138222178
CTintergenicDe novo--Yuen2017 G
TNFAIP3     1-0201-005chr6:
138358074-138358074
GAintergenicDe novo--Yuen2017 G
TNFAIP3     2-1164-003chr6:
138190773-138190773
CTintronicDe novo--Yuen2016 G
Yuen2017 G
TNFAIP3     1-0344-003chr6:
138248449-138248449
CTintergenicDe novo--Yuen2017 G
TNFAIP3     1-0595-004chr6:
138405400-138405400
TCintergenicDe novo--Yuen2017 G
TNFAIP3     2-1235-003chr6:
138284868-138284868
CTintergenicDe novo--Yuen2017 G
TNFAIP3     2-1375-003chr6:
138391261-138391301
GGTGTGTGTGTGTGTGCGTGTGTGTGCGTGTGTGTGTGTGTGGTGTGTGTGTGTGCGTGTGTGTGCGTGTGTGTGTGTGTintergenicDe novo--Yuen2017 G
TNFAIP3     AU2975302chr6:
138347858-138347858
CTintergenicDe novo--Yuen2017 G
TNFAIP3     1-0366-003chr6:
138196072-138196072
CCGCTCAAGGAAACAGACAexonicDe novoframeshift insertionNM_001270507
NM_001270508
NM_006290
c.386_387insGCTCAAGGAAACAGACA
c.386_387insGCTCAAGGAAACAGACA
c.386_387insGCTCAAGGAAACAGACA
p.T129fs
p.T129fs
p.T129fs
--Yuen2015 G
TNFAIP3     A25chr6:
138206013-138206013
CTintergenicDe novo--Wu2018 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More