or
or
Exact

Results for "CA10"

Variant Events: 79

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CA10     2-1522-003chr17:
50939213-50939213
TCintergenicDe novo--Yuen2017 G
CA10     2-1399-003chr17:
50620645-50620645
TCintergenicDe novo--Yuen2017 G
CA10     2-1715-003chr17:
50045735-50045743
GAAATACTAGintronicDe novo--Yuen2017 G
CA10     2-1155-003chr17:
50107619-50107619
TAintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     AU4223302chr17:
50977435-50977435
AGintergenicDe novo--Yuen2017 G
CA10     1-0569-003chr17:
50714938-50714938
CTintergenicDe novo--Yuen2017 G
CA10     1-0715-003chr17:
50454191-50454191
CGintergenicDe novo--Yuen2017 G
CA10     AU4067301chr17:
50847796-50847796
TCintergenicDe novo--Yuen2017 G
CA10     1-0329-004chr17:
50363845-50363845
ACintergenicDe novo--Yuen2017 G
CA10     AU3636302chr17:
50300620-50300620
TAintergenicDe novo--Yuen2017 G
CA10     5-0087-003chr17:
50401078-50401078
TGintergenicDe novo--Yuen2017 G
CA10     2-0306-003chr17:
50052997-50052997
TGintronicDe novo--Yuen2016 G
CA10     2-1529-003chr17:
50962051-50962052
ATAintergenicDe novo--Yuen2017 G
CA10     1-0338-003chr17:
50892450-50892450
GAintergenicDe novo--Yuen2017 G
CA10     DEASD_0100_001chr17:
49713356-49713356
GAexonicDe novosynonymous SNVNM_020178
NM_001082533
NM_001082534
c.C649T
c.C649T
c.C649T
p.L217L
p.L217L
p.L217L
--DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
CA10     7-0130-003chr17:
50727775-50727775
CCCATAATATTACAintergenicDe novo--Yuen2017 G
CA10     1-0526-003chr17:
49844126-49844131
TAACTCTintronicDe novo--Yuen2017 G
CA10     1-0045-004chr17:
51049342-51049342
GAintergenicDe novo--Yuen2017 G
CA10     AU051504chr17:
49957067-49957067
TCintronicDe novo--Yuen2017 G
CA10     1-0009-004chr17:
50386317-50386317
AGintergenicDe novo--Yuen2017 G
CA10     1-0045-004chr17:
49989553-49989553
CAintronicDe novo--Yuen2017 G
CA10     1-0925-003chr17:
50626387-50626387
GAintergenicDe novo--Yuen2017 G
CA10     1-1004-003chr17:
49897358-49897358
TCintronicDe novo--Yuen2017 G
CA10     2-1279-003chr17:
50713731-50713731
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
CA10     2-1357-003chr17:
50944721-50944721
AGintergenicDe novo--Yuen2017 G
CA10     1-0871-003chr17:
50216273-50216273
TCintronicDe novo--Yuen2017 G
CA10     AU3937301chr17:
49887851-49887851
GAintronicDe novo--Yuen2017 G
CA10     1-0206-003chr17:
50790944-50790944
CGintergenicDe novo--Yuen2017 G
CA10     1-0863-003chr17:
50605418-50605418
AGintergenicDe novo--Yuen2017 G
CA10     2-1148-004chr17:
50892495-50892495
GAintergenicDe novo--Yuen2017 G
CA10     AU3888302chr17:
50273834-50273834
GAintergenicDe novo--Yuen2017 G
CA10     2-0116-005chr17:
50703738-50703738
GAintergenicDe novo--Yuen2017 G
CA10     1-0756-004chr17:
49728907-49728920
GGTCTACAGCCTAAGintronicDe novo--Yuen2017 G
CA10     2-0704-003chr17:
50039168-50039168
GAintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     5-0018-003chr17:
50745836-50745836
ACintergenicDe novo--Yuen2017 G
CA10     2-0116-005chr17:
50960601-50960601
GAintergenicDe novo--Yuen2017 G
CA10     AU3874301chr17:
50657509-50657509
CAintergenicDe novo--Yuen2017 G
CA10     Chen2017:111chr17:
50235121-50235121
AGexonicDe novononsynonymous SNVNM_020178
NM_001082533
NM_001082534
c.T26C
c.T26C
c.T26C
p.F9S
p.F9S
p.F9S
14.91-Chen2017 E
CA10     AU3809302chr17:
50206047-50206047
GAintronicDe novo--Yuen2017 G
CA10     2-1242-003chr17:
50120425-50120425
TCintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     7-0095-004chr17:
50208066-50208066
CCTTTTTTTTTGTTTTTTTGTintronicDe novo--Yuen2017 G
CA10     2-0129-004chr17:
50879537-50879537
AATintergenicDe novo--Yuen2017 G
CA10     A12chr17:
50285129-50285129
CTintergenicDe novo--Wu2018 G
CA10     2-1384-003chr17:
50461434-50461434
TCintergenicDe novo--Yuen2017 G
CA10     1-0045-003chr17:
50145427-50145427
GAintronicDe novo--Yuen2017 G
CA10     AU2458303chr17:
50417640-50417640
GAintergenicDe novo--Yuen2017 G
CA10     1-0572-003chr17:
50621550-50621550
CGintergenicDe novo--Yuen2017 G
CA10     2-1168-003chr17:
50781614-50781614
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
CA10     2-0210-005chr17:
51037531-51037531
GTintergenicDe novo--Yuen2017 G
CA10     2-0306-004chr17:
50052997-50052997
TGintronicDe novo--Yuen2017 G
CA10     AU3713302chr17:
50669579-50669587
GTTATTATTGTTATTintergenicDe novo--Yuen2017 G
CA10     7-0067-003chr17:
49951035-49951035
GTintronicDe novo--Yuen2017 G
CA10     AU4233301chr17:
50147646-50147646
TGintronicDe novo--Yuen2017 G
CA10     1-0173-004chr17:
49963361-49963361
GAintronicDe novo--Yuen2017 G
CA10     2-1620-004chr17:
50409433-50409433
CTintergenicDe novo--Yuen2017 G
CA10     2-1736-003chr17:
50350062-50350071
TTCTCTCTCTTTCTCTintergenicDe novo--Yuen2017 G
CA10     2-0318-004chr17:
51056000-51056000
AGintergenicDe novo--Yuen2017 G
CA10     3-0140-000chr17:
49750333-49750333
AGintronicDe novo--Yuen2017 G
CA10     1-0320-003chr17:
49710999-49710999
GAexonicDe novononsynonymous SNVNM_020178
NM_001082533
NM_001082534
c.C802T
c.C802T
c.C802T
p.R268C
p.R268C
p.R268C
20.5-Yuen2015 G
CA10     09C86110chr17:
50212327-50212327
TCintronicDe novo--Kosmicki2017 E
Satterstrom2020 E
CA10     AU4013301chr17:
51027069-51027069
GAintergenicDe novo--Yuen2017 G
CA10     1-0325-003chr17:
49880840-49880840
CAintronicDe novo--Yuen2017 G
CA10     1-0571-003chr17:
50410426-50410426
TCintergenicDe novo--Yuen2017 G
CA10     1-0336-003chr17:
50722317-50722317
GAintergenicDe novo--Yuen2017 G
CA10     2-0242-004chr17:
50891667-50891667
CCTintergenicDe novo--Yuen2017 G
CA10     2-1305-003chr17:
50119442-50119442
CGintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     AU3632301chr17:
50717794-50717794
TCintergenicDe novo--Yuen2017 G
CA10     2-1731-003chr17:
50241941-50241941
TCintergenicDe novo--Yuen2017 G
CA10     CC1132.201chr17:
49710999-49710999
GAexonicDe novononsynonymous SNVNM_020178
NM_001082533
NM_001082534
c.C802T
c.C802T
c.C802T
p.R268C
p.R268C
p.R268C
20.5-Satterstrom2020 E
CA10     AU079104chr17:
50981004-50981004
TCintergenicDe novo--Yuen2017 G
CA10     AU4153301chr17:
50260437-50260437
CTintergenicDe novo--Yuen2017 G
CA10     3-0447-000chr17:
50149809-50149809
CTintronicDe novo--Yuen2016 G
Yuen2017 G
CA10     A18chr17:
50910175-50910175
AGintergenicDe novo--Wu2018 G
CA10     2-0305-004chr17:
50549429-50549429
AGintergenicDe novo--Yuen2017 G
CA10     1-0405-003chr17:
51030829-51030830
ACAintergenicDe novo--Yuen2017 G
CA10     2-1427-003chr17:
50158879-50158879
GTintronicDe novo--Yuen2017 G
CA10     2-1617-003chr17:
50915186-50915186
GAintergenicDe novo--Yuen2017 G
CA10     AU060703chr17:
50790741-50790741
TCintergenicDe novo--Yuen2017 G
CA10     AU4032306chr17:
49801819-49801819
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More