or
or
Exact

Results for "KIAA1217"

Variant Events: 47

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
KIAA1217     1-0215-006chr10:
24723252-24723252
GAintronicDe novo--Yuen2017 G
KIAA1217     2-0256-004chr10:
24280690-24280690
GAintronicDe novo--Yuen2017 G
KIAA1217     AU4228301chr10:
24576526-24576526
TCintronicDe novo--Yuen2017 G
KIAA1217     2-1370-003chr10:
24802273-24802273
TCexonicDe novononsynonymous SNVNM_001282769
NM_001282770
NM_001282767
NM_001282768
NM_019590
NM_001098500
c.T1136C
c.T1136C
c.T1982C
c.T1982C
c.T2087C
c.T1847C
p.L379P
p.L379P
p.L661P
p.L661P
p.L696P
p.L616P
15.45-Jiang2013 G
Yuen2016 G
Yuen2017 G
KIAA1217     1-0806-003chr10:
24775367-24775367
TAintronicDe novo--Yuen2017 G
KIAA1217     1-0051-004chr10:
24293241-24293244
CAGGCintronicDe novo--Yuen2017 G
KIAA1217     AU061104chr10:
24818526-24818526
ACintronicDe novo--Yuen2017 G
KIAA1217     AU1848302 Complex Event; expand row to view variants  De novo--Yuen2017 G
Yuen2017 G
KIAA1217     2-1299-003chr10:
24034420-24034420
AGintronicDe novo--Yuen2017 G
KIAA1217     5-0073-003chr10:
24519312-24519312
CTintronicDe novo--Yuen2017 G
KIAA1217     7-0008-003chr10:
24696226-24696226
CTintronicDe novo--Yuen2017 G
KIAA1217     2-0142-003chr10:
24093410-24093410
TCintronicDe novo--Yuen2017 G
KIAA1217     1-0323-003chr10:
24804824-24804824
GCintronicDe novo--Yuen2017 G
KIAA1217     1-0385-003chr10:
24412023-24412023
CTintronicDe novo--Yuen2017 G
KIAA1217     12287.p1chr10:
24832972-24832972
CTexonicDe novosynonymous SNVNM_019590c.C4773Tp.T1591T-7.441E-5Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
KIAA1217     1-0512-003chr10:
24069617-24069617
GAintronicDe novo--Yuen2017 G
KIAA1217     1-0925-003chr10:
24452914-24452914
GAintronicDe novo--Yuen2017 G
KIAA1217     1-0292-003chr10:
24822132-24822132
ACexonicDe novononsynonymous SNVNM_001282769
NM_001282770
NM_001282767
NM_001282768
NM_019590
NM_001098500
c.A2429C
c.A2429C
c.A3272C
c.A3275C
c.A3380C
c.A3140C
p.E810A
p.E810A
p.E1091A
p.E1092A
p.E1127A
p.E1047A
18.79-Yuen2015 G
KIAA1217     2-1089-004chr10:
24555887-24555887
AGintronicDe novo--Yuen2017 G
KIAA1217     AU4067303chr10:
24154957-24154957
GAintronicDe novo--Yuen2017 G
KIAA1217     AU3852301chr10:
24701992-24701992
GAintronicDe novo--Yuen2017 G
KIAA1217     1-0994-003chr10:
24800847-24800847
CTintronicDe novo--Yuen2017 G
KIAA1217     7-0129-003chr10:
24657325-24657325
CTintronicDe novo--Yuen2017 G
KIAA1217     2-1246-003chr10:
24306260-24306260
AGintronicDe novo--Yuen2017 G
KIAA1217     2-1275-003chr10:
24485772-24485772
GCintronicDe novo--Yuen2017 G
KIAA1217     1-0668-003chr10:
24785784-24785784
CAintronicDe novo--Yuen2017 G
KIAA1217     2-1206-003chr10:
24688171-24688171
TGintronicDe novo--Yuen2016 G
Yuen2017 G
KIAA1217     2-1266-003 Complex Event; expand row to view variants  De novo--Yuen2016 G
Yuen2017 G
KIAA1217     5-0146-003chr10:
24621497-24621497
CTintronicDe novo--Yuen2017 G
KIAA1217     AU4215302chr10:
24110727-24110727
GTintronicDe novo--Yuen2017 G
KIAA1217     AU3889305chr10:
24277190-24277190
CTintronicDe novo--Yuen2017 G
KIAA1217     2-1425-004chr10:
24014816-24014816
CAintronicDe novo--Yuen2017 G
KIAA1217     2-1718-003chr10:
24183705-24183705
CGintronicDe novo--Yuen2017 G
KIAA1217     A3chr10:
24632442-24632442
TAintronicDe novo--Wu2018 G
KIAA1217     AU3154301chr10:
24424242-24424242
AGintronicDe novo--Yuen2017 G
KIAA1217     7-0175-003chr10:
24392425-24392425
CGintronicDe novo--Yuen2017 G
KIAA1217     AU027506chr10:
24580365-24580365
ACintronicDe novo--Yuen2017 G
KIAA1217     11341.p1chr10:
24126588-24126588
CTintronicDe novo--Turner2016 G
KIAA1217     1-0025-006chr10:
24494862-24494862
CTintronicDe novo--Yuen2017 G
KIAA1217     AU3875301chr10:
24150417-24150417
CTintronicDe novo--Yuen2017 G
KIAA1217     1-0244-003chr10:
24045196-24045196
TAintronicDe novo--Yuen2017 G
KIAA1217     1-0092-003chr10:
24287269-24287269
AAGGTTintronicDe novo--Yuen2017 G
KIAA1217     1-0158-012chr10:
24642552-24642552
TCintronicDe novo--Yuen2017 G
KIAA1217     2-1644-003chr10:
24237911-24237911
ACintronicDe novo--Yuen2017 G
KIAA1217     1-0495-003chr10:
24646509-24646509
CGintronicDe novo--Yuen2017 G
KIAA1217     1-0539-003chr10:
24281766-24281766
ACintronicDe novo--Yuen2017 G
KIAA1217     1-0508-003chr10:
24092815-24092828
TACACACACACACATACACACACACAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More