or
or
Exact

Results for "PLEKHB2"

Variant Events: 5

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PLEKHB2     YP016chr2:
131883481-131883481
AACTCAGCCCCCGGATGGAAAGTCAAAAGACTGCATGCTCCAGATTGTTTGTCGintronicDe novo--Satterstrom2020 E
PLEKHB2     1-0330-004chr2:
131897771-131897771
CTexonicDe novononsynonymous SNVNM_001267067
NM_001267068
NM_001309450
NM_001309448
NM_001309451
NM_001100623
NM_001267062
NM_001267063
NM_001267064
NM_001267065
NM_017958
NM_001309452
c.C325T
c.C322T
c.C209T
c.C311T
c.C308T
c.C455T
c.C455T
c.C452T
c.C476T
c.C479T
c.C452T
c.C311T
p.R109C
p.R108C
p.A70V
p.A104V
p.A103V
p.A152V
p.A152V
p.A151V
p.A159V
p.A160V
p.A151V
p.A104V
6.228.372E-6Yuen2015 G
Yuen2017 G
PLEKHB2     1-0330-004chr2:
131907390-131907391
CACUTR3De novo--Yuen2017 G
PLEKHB2     1-0458-005chr2:
131871060-131871060
TCintronicDe novo--Yuen2017 G
PLEKHB2     5-0140-003chr2:
131879407-131879407
CTintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More