or
or
Exact

Results for "NXPH1"

Variant Events: 80

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NXPH1     AU017703chr7:
9400243-9400243
GAintergenicDe novo--Yuen2017 G
NXPH1     A23chr7:
8480686-8480686
GTintronicDe novo--Wu2018 G
NXPH1     1-0025-006chr7:
8790713-8790713
CAexonicDe novononsynonymous SNVNM_152745c.C130Ap.H44N11.5-Yuen2015 G
NXPH1     1-0552-003chr7:
9521879-9521879
TCintergenicDe novo--Yuen2017 G
NXPH1     2-0309-005chr7:
8737961-8737961
AGintronicDe novo--Yuen2017 G
NXPH1     AU3794302chr7:
9003344-9003351
ATATGTATATATintergenicDe novo--Yuen2017 G
NXPH1     AU4234302chr7:
9224560-9224560
GCintergenicDe novo--Yuen2017 G
NXPH1     2-1251-003chr7:
9200241-9200241
TCintergenicDe novo--Yuen2017 G
NXPH1     1-0464-003chr7:
9385435-9385435
CGintergenicDe novo--Yuen2016 G
Yuen2017 G
NXPH1     1-0329-003chr7:
9285844-9285844
GCintergenicDe novo--Yuen2017 G
NXPH1     1-0835-003chr7:
9187496-9187496
CAintergenicDe novo--Yuen2017 G
NXPH1     2-1329-003chr7:
8580349-8580349
ACintronicDe novo--Yuen2016 G
Yuen2017 G
NXPH1     2-1526-003chr7:
9203293-9203293
AATGATGGTintergenicDe novo--Yuen2017 G
NXPH1     1-0352-005chr7:
8490061-8490061
GCintronicDe novo--Yuen2017 G
NXPH1     AU018010chr7:
9624142-9624142
GTintergenicDe novo--Yuen2017 G
NXPH1     AU3760302chr7:
8664319-8664319
ACintronicDe novo--Yuen2017 G
NXPH1     3-0396-000chr7:
9610185-9610185
ATintergenicDe novo--Yuen2016 G
NXPH1     AU3517302chr7:
9077574-9077574
TCintergenicDe novo--Yuen2017 G
NXPH1     AU4033305chr7:
9055669-9055669
TCintergenicDe novo--Yuen2017 G
NXPH1     1-0448-003chr7:
8510292-8510292
CTintronicDe novo--Yuen2017 G
NXPH1     AU3905301chr7:
8707857-8707857
GAintronicDe novo--Yuen2017 G
NXPH1     2-1594-003chr7:
9484104-9484104
TGintergenicDe novo--Yuen2017 G
NXPH1     AU4487302chr7:
8615654-8615654
GCintronicDe novo--Yuen2017 G
NXPH1     2-0286-004chr7:
8802811-8802811
CTintergenicDe novo--Yuen2017 G
NXPH1     AU4054302chr7:
9380457-9380457
ACintergenicDe novo--Yuen2017 G
NXPH1     2-1278-003chr7:
9325841-9325841
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
NXPH1     2-1633-003chr7:
9065865-9065865
TAintergenicDe novo--Yuen2017 G
NXPH1     2-1182-003chr7:
9074803-9074803
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
NXPH1     1-0706-003chr7:
8808405-8808405
CTintergenicDe novo--Yuen2017 G
NXPH1     AU1952305chr7:
9287436-9287436
TAintergenicDe novo--Yuen2017 G
NXPH1     AU2123302chr7:
8803194-8803203
ATCTCTCTCTATCTCTCTCTCTintergenicDe novo--Yuen2017 G
NXPH1     2-1356-003chr7:
9312470-9312470
ACintergenicDe novo--Yuen2016 G
Yuen2017 G
NXPH1     7-0058-003chr7:
8663294-8663294
TTCTCTAGGintronicDe novo--Yuen2017 G
NXPH1     AU057404chr7:
8761853-8761853
TCintronicDe novo--Yuen2017 G
NXPH1     1-0271-003chr7:
9567345-9567345
TCintergenicDe novo--Yuen2017 G
NXPH1     7-0100-003chr7:
8963980-8963980
GAintergenicDe novo--Yuen2017 G
NXPH1     AU3637301chr7:
9414804-9414804
CTintergenicDe novo--Yuen2017 G
NXPH1     AU3646301chr7:
8673126-8673126
CTintronicDe novo--Yuen2017 G
NXPH1     1-0433-004chr7:
9002289-9002289
ACintergenicDe novo--Yuen2017 G
NXPH1     1-0080-003chr7:
8707707-8707707
TCintronicDe novo--Yuen2017 G
NXPH1     1-0372-003chr7:
9632389-9632389
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NXPH1     2-1501-003chr7:
9143733-9143733
TCintergenicDe novo--Yuen2017 G
NXPH1     1-0347-003chr7:
8937145-8937145
GCintergenicDe novo--Yuen2017 G
NXPH1     2-1184-003chr7:
9409816-9409816
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
NXPH1     AU011704chr7:
9007157-9007160
CTTTCintergenicDe novo--Yuen2017 G
NXPH1     60-2027chr7:
8739034-8739034
AGintronicDe novo--Michaelson2012 G
NXPH1     AU3451301chr7:
8893764-8893764
GAintergenicDe novo--Yuen2017 G
NXPH1     AU4237301chr7:
9036206-9036206
GTintergenicDe novo--Yuen2017 G
NXPH1     13946.p1chr7:
9013236-9013236
CTintergenicDe novo--Turner2016 G
NXPH1     1-0121-003chr7:
8865192-8865192
TCintergenicDe novo--Yuen2017 G
NXPH1     AU017704chr7:
8577275-8577275
CAintronicDe novo--Yuen2017 G
NXPH1     AU3911302chr7:
9403978-9403978
CTintergenicDe novo--Yuen2017 G
NXPH1     ASP055chr7:
8790890-8790890
AGexonicDe novononsynonymous SNVNM_152745c.A307Gp.R103G14.77-Satterstrom2020 E
NXPH1     AU012803chr7:
8849003-8849003
TCintergenicDe novo--Yuen2017 G
NXPH1     AU1542301chr7:
8709211-8709216
CTGGTGCTGintronicDe novo--Yuen2017 G
NXPH1     1-0466-003chr7:
9654792-9654792
GAintergenicDe novo--Yuen2017 G
NXPH1     7-0253-005chr7:
8921097-8921097
CTintergenicDe novo--Yuen2017 G
NXPH1     AU3881301chr7:
9465712-9465712
CGintergenicDe novo--Yuen2017 G
NXPH1     1-0295-003chr7:
8768173-8768173
CTintronicDe novo--Yuen2017 G
NXPH1     1-0295-003chr7:
8764458-8764458
TAintronicDe novo--Yuen2017 G
NXPH1     5-0077-003chr7:
8635105-8635105
CCATintronicDe novo--Yuen2017 G
NXPH1     JASD_Fam0162chr7:
8790890-8790890
AGexonicDe novononsynonymous SNVNM_152745c.A307Gp.R103G14.77-Takata2018 E
NXPH1     1-0701-003chr7:
8899057-8899057
CTintergenicDe novo--Yuen2017 G
NXPH1     1-0826-004chr7:
9377182-9377182
GAintergenicDe novo--Yuen2017 G
NXPH1     7-0253-005chr7:
9617091-9617091
TCintergenicDe novo--Yuen2017 G
NXPH1     AU0780302chr7:
9150094-9150094
CTintergenicDe novo--Yuen2017 G
NXPH1     AU2381302chr7:
9321279-9321279
TAintergenicDe novo--Yuen2017 G
NXPH1     AU011604chr7:
9476471-9476471
GAintergenicDe novo--Yuen2017 G
NXPH1     1-1004-003chr7:
9480211-9480211
CGintergenicDe novo--Yuen2017 G
NXPH1     AU4092302chr7:
9082734-9082734
GAintergenicDe novo--Yuen2017 G
NXPH1     1-0352-003chr7:
8490061-8490061
GCintronicDe novo--Yuen2016 G
NXPH1     5-0015-003chr7:
8750653-8750653
CAintronicDe novo--Yuen2017 G
NXPH1     3-0430-000chr7:
9370026-9370026
GAintergenicDe novo--Yuen2016 G
NXPH1     5-0055-004chr7:
8909000-8909000
TCintergenicDe novo--Yuen2017 G
NXPH1     1-0531-003chr7:
8481130-8481130
AGintronicDe novo--Yuen2016 G
Yuen2017 G
NXPH1     2-0149-003chr7:
9264103-9264103
CGintergenicDe novo--Yuen2017 G
NXPH1     AU4250301chr7:
8969994-8969994
AGintergenicDe novo--Yuen2017 G
NXPH1     5-0025-004chr7:
9194655-9194655
TTCintergenicDe novo--Yuen2017 G
NXPH1     AU2485305chr7:
9640320-9640320
CTintergenicDe novo--Yuen2017 G
NXPH1     3-0065-000chr7:
9579520-9579533
TTCTCTCTCTCTCTTTCTCTCTCTCTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More