or
or
Exact

Results for "GRIK1"

Variant Events: 42

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GRIK1     2-1452-003chr21:
31366623-31366623
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
GRIK1     5-0116-003chr21:
31463061-31463061
CTintergenicDe novo--Yuen2017 G
GRIK1     2-0273-003chr21:
31381803-31381803
GCintergenicDe novo--Yuen2017 G
GRIK1     AU3874303chr21:
31378255-31378255
AGintergenicDe novo--Yuen2017 G
GRIK1     AU0146302chr21:
31280089-31280089
AGintronicDe novo--Yuen2017 G
GRIK1     AU4308302chr21:
31186817-31186817
TCintronicDe novo--Yuen2017 G
GRIK1     2-0296-003chr21:
31073213-31073216
AAACAintronicDe novo--Yuen2017 G
GRIK1     5-0099-003chr21:
30826014-30826014
TCintergenicDe novo--Yuen2017 G
GRIK1     AU3730301chr21:
31053545-31053549
TCCCCTCCCintronicDe novo--Yuen2017 G
GRIK1     1-0595-004chr21:
31191506-31191506
GAintronicDe novo--Yuen2017 G
GRIK1     63-343chr21:
31325473-31325473
GAintergenicDe novo--Michaelson2012 G
GRIK1     1-0263-003chr21:
31436591-31436591
GAintergenicDe novo--Yuen2016 G
GRIK1     5-0055-003chr21:
31104322-31104322
GAintronicDe novo--Yuen2017 G
GRIK1     1-0155-003chr21:
31282629-31282629
TCintronicDe novo--Yuen2017 G
GRIK1     2-1128-003chr21:
31338596-31338596
GAintergenicDe novo--Yuen2017 G
GRIK1     AU3964302chr21:
31464593-31464593
TGintergenicDe novo--Yuen2017 G
GRIK1     1-0559-005chr21:
31424002-31424002
GAintergenicDe novo--Yuen2017 G
GRIK1     5-0054-003chr21:
30804685-30804685
TCintergenicDe novo--Yuen2017 G
GRIK1     5-0111-003chr21:
31158547-31158547
GAintronicDe novo--Yuen2017 G
GRIK1     2-1360-003chr21:
30767189-30767189
GCintergenicDe novo--Yuen2016 G
Yuen2017 G
GRIK1     A29chr21:
30875941-30875941
AGintergenicDe novo--Wu2018 G
GRIK1     AU3984302chr21:
31224101-31224101
CTintronicDe novo--Yuen2017 G
GRIK1     2-1194-003chr21:
31422472-31422472
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
GRIK1     2-1360-003chr21:
30904194-30904194
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
GRIK1     1-0248-003chr21:
31380420-31380420
TCintergenicDe novo--Yuen2017 G
GRIK1     2-1291-003chr21:
30807216-30807216
GAintergenicDe novo--Yuen2016 G
Yuen2017 G
GRIK1     5-0077-004chr21:
31260478-31260478
TTCintronicDe novo--Yuen2017 G
GRIK1     08C78065chr21:
30949318-30949318
GAexonicDe novononsynonymous SNVNM_175611
NM_000830
c.C2051T
c.C2096T
p.A684V
p.A699V
19.41.648E-5DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
GRIK1     AU4093302chr21:
31114129-31114129
GAintronicDe novo--Yuen2017 G
GRIK1     7-0160-003chr21:
31177099-31177099
ATintronicDe novo--Yuen2017 G
GRIK1     7-0191-003chr21:
30795401-30795401
CTintergenicDe novo--Yuen2017 G
GRIK1     5-0050-003chr21:
30922165-30922165
TCintronicDe novo--Yuen2017 G
GRIK1     AU2139303chr21:
31312882-31312882
AGupstreamDe novo--Yuen2017 G
GRIK1     2-0319-004chr21:
31311702-31311702
GAexonicDe novosynonymous SNVNM_000830
NM_175611
c.C117T
c.C117T
p.I39I
p.I39I
--Yuen2015 G
Yuen2017 G
GRIK1     1-0497-003chr21:
31046977-31046991
GCTCTCTCTCTCTCTGCTCTCTCTCTCTintronicDe novo--Yuen2017 G
GRIK1     2-1205-003chr21:
30932646-30932649
TTCTTTintronicDe novo--Yuen2017 G
GRIK1     AU048206chr21:
30769453-30769453
AGintergenicDe novo--Yuen2017 G
GRIK1     AU1940304chr21:
31065258-31065258
AGintronicDe novo--Yuen2017 G
GRIK1     2-1295-003chr21:
31350161-31350161
CTintergenicDe novo--Yuen2017 G
GRIK1     AU3057301chr21:
31327098-31327098
ATintergenicDe novo--Yuen2017 G
GRIK1     1-0201-004chr21:
30961291-30961291
GTexonicDe novostopgainNM_175611
NM_000830
c.C1392A
c.C1437A
p.C464X
p.C479X
34.0-Yuen2017 G
GRIK1     2-1477-003chr21:
31476738-31476738
TCintergenicDe novo--Yuen2016 G
Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More