or
or
Exact

Results for "NARF"

Variant Events: 8

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NARF     086-09-110952chr17:
80442773-80442773
GAexonicDe novosynonymous SNVNM_001083608
NM_001038618
NM_012336
c.G774A
c.G741A
c.G918A
p.A258A
p.A247A
p.A306A
-4.148E-5Satterstrom2020 E
NARF     EGAN00001101337chr17:
80445752-80445752
GAintronicDe novo-2.567E-5Satterstrom2020 E
NARF     AU051Achr17:
80439007-80439007
AGexonicDe novononsynonymous SNVNM_001083608
NM_001038618
NM_012336
c.A545G
c.A512G
c.A689G
p.D182G
p.D171G
p.D230G
12.39-Lim2017 E
NARF     2-1425-004chr17:
80439005-80439005
TCexonicDe novosynonymous SNVNM_001083608
NM_001038618
NM_012336
c.T543C
c.T510C
c.T687C
p.Y181Y
p.Y170Y
p.Y229Y
--Yuen2015 G
Yuen2017 G
NARF     1-0570-003chr17:
80466942-80466942
ATintergenicDe novo--Yuen2017 G
NARF     Cukier2014:7590chr17:
80439004-80439004
AGexonicUnknownnonsynonymous SNVNM_001083608
NM_001038618
NM_012336
c.A542G
c.A509G
c.A686G
p.Y181C
p.Y170C
p.Y229C
10.170.0037Cukier2014 E
NARF     2-0270-004chr17:
80449804-80449804
GGTTCTGAAATCAAGGAGAGCAGGTGCCAGGGCTGTCintergenicDe novo--Yuen2017 G
NARF     1-0193-003chr17:
80424168-80424169
CTCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More