or
or
Exact

Results for "DAAM2"

Variant Events: 16

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DAAM2     2-0003-003chr6:
39812957-39812957
TTATACAACCTAAACATACintronicDe novo--Yuen2017 G
DAAM2     2-1480-003chr6:
39836940-39836940
CGintronicDe novo--Yuen2016 G
Yuen2017 G
DAAM2     AU2215302chr6:
39803934-39803934
CAintronicDe novo--Yuen2017 G
DAAM2     2-0298-003chr6:
39813110-39813110
TTATAGTCATAintronicDe novo--Yuen2017 G
DAAM2     PN400457chr6:
39851798-39851798
GTexonicUnknownnonsynonymous SNVNM_001201427
NM_015345
c.G1906T
c.G1906T
p.D636Y
p.D636Y
31.01.719E-5Leblond2019 E
DAAM2     1-0526-003chr6:
39812807-39812807
TTCACACATACATACCATATCintronicDe novo--Yuen2017 G
DAAM2     PN400343chr6:
39846320-39846320
CTexonicUnknownnonsynonymous SNVNM_001201427
NM_015345
c.C1501T
c.C1501T
p.R501W
p.R501W
20.9-Leblond2019 E
DAAM2     08C76519chr6:
39838132-39838132
GAexonicDe novononsynonymous SNVNM_001201427
NM_015345
c.G890A
c.G890A
p.R297H
p.R297H
36.0-Satterstrom2020 E
DAAM2     2-0007-004chr6:
39869186-39869186
GTexonicDe novononsynonymous SNVNM_001201427
NM_015345
c.G2920T
c.G2917T
p.D974Y
p.D973Y
29.7-Yuen2015 G
Yuen2017 G
DAAM2     2-0304-003chr6:
39766445-39766445
CTintronicDe novo--Yuen2017 G
DAAM2     1-0150-004chr6:
39813202-39813202
CCAintronicDe novo--Yuen2017 G
DAAM2     2-1315-003chr6:
39782494-39782494
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DAAM2     2-1562-004chr6:
39812807-39812807
TTCintronicDe novo--Yuen2017 G
DAAM2     AU051504chr6:
39765425-39765425
GTintronicDe novo--Yuen2017 G
DAAM2     2-0305-004chr6:
39847736-39847736
AGintronicDe novo--Yuen2017 G
DAAM2     2-0297-003chr6:
39777134-39777134
GCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More