or
or
Exact

Results for "SMG6"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SMG6     AU031004chr17:
2063857-2063857
CTintronicDe novo--Yuen2017 G
SMG6     AU075308chr17:
2203527-2203527
GTexonicUnknownnonsynonymous SNVNM_017575c.C520Ap.Q174K8.2250.001Chahrour2012 E
SMG6     AU1848302chr17:
2123323-2123323
CTintronicDe novo--Yuen2017 G
SMG6     1-0338-005chr17:
1993748-1993748
TGintronicDe novo--Yuen2017 G
SMG6     1-0565-003chr17:
1988578-1988578
GAintronicDe novo--Yuen2017 G
SMG6     1-0155-003chr17:
2009714-2009718
GAAAAGAAAAAintronicDe novo--Yuen2017 G
SMG6     AU3721302chr17:
2131972-2131981
CATATATATACATATATATATAintronicDe novo--Yuen2017 G
SMG6     12108.p1chr17:
2203809-2203809
TCexonicDe novononsynonymous SNVNM_017575c.A238Gp.N80D12.2-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Lim2017 E
Satterstrom2020 E
Wilfert2021 G
SMG6     1-0099-003chr17:
2194312-2194312
TCintronicDe novo--Yuen2017 G
SMG6     2-1153-003chr17:
1974127-1974127
CTintronicDe novo--Yuen2016 G
Yuen2017 G
SMG6     AU075308chr17:
2202480-2202480
TCexonicUnknownnonsynonymous SNVNM_017575c.A1567Gp.T523A0.0043.0E-4Chahrour2012 E
SMG6     80001103390chr17:
2202772-2202772
TCexonicDe novosynonymous SNVNM_017575c.A1275Gp.P425P-3.298E-5Satterstrom2020 E
SMG6     1-0279-004chr17:
2091719-2091719
GAexonicDe novononsynonymous SNVNM_001256828
NM_001256827
NM_017575
c.C236T
c.C236T
c.C2960T
p.T79I
p.T79I
p.T987I
10.27-Yuen2015 G
Yuen2017 G
SMG6     5-0077-004chr17:
2001273-2001273
CGintronicDe novo--Yuen2017 G
SMG6     1-0043-003chr17:
2184185-2184185
GAintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More