or
or
Exact

Results for "DACH1"

Variant Events: 55

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
DACH1     11002.p1chr13:
72120338-72120338
GAintronicDe novo--Turner2016 G
DACH1     A28chr13:
73047634-73047634
CTintergenicDe novo--Wu2018 G
DACH1     2-0022-004chr13:
72662061-72662061
CTintergenicDe novo--Yuen2017 G
DACH1     7-0103-003chr13:
72823495-72823495
CAintergenicDe novo--Yuen2017 G
DACH1     1-0606-003chr13:
72509918-72509918
TCintergenicDe novo--Yuen2017 G
DACH1     1-0224-004chr13:
72888464-72888464
GTintergenicDe novo--Yuen2017 G
DACH1     2-1169-003chr13:
72779339-72779339
TGintergenicDe novo--Yuen2017 G
DACH1     AU003403chr13:
73113110-73113110
CAintergenicDe novo--Yuen2017 G
DACH1     2-1137-003chr13:
73197567-73197567
CTintergenicDe novo--Yuen2016 G
Yuen2017 G
DACH1     1-0403-004chr13:
72134055-72134055
GTexonicDe novosynonymous SNVNM_080759c.C1338Ap.P446P--Yuen2015 G
Yuen2017 G
DACH1     AU4176302chr13:
72671027-72671031
TTGTGTTGintergenicDe novo--Yuen2017 G
DACH1     AU1725306chr13:
72199793-72199793
CTintronicDe novo--Yuen2017 G
DACH1     7-0255-003chr13:
72946900-72946900
CGintergenicDe novo--Yuen2017 G
DACH1     AU056803chr13:
73088048-73088048
GCintergenicDe novo--Yuen2017 G
DACH1     AU1995302chr13:
72361041-72361041
ATintronicDe novo--Yuen2017 G
DACH1     2-1353-003chr13:
72079622-72079637
CTGTGTGTGTGTGTGTCTGTGTGTGTGTGTintronicDe novo--Yuen2017 G
DACH1     AU4365302chr13:
72916776-72916776
CTintergenicDe novo--Yuen2017 G
DACH1     A4chr13:
72068711-72068711
GAintronicDe novo--Wu2018 G
DACH1     2-0300-003chr13:
73248174-73248174
GTintergenicDe novo--Yuen2017 G
DACH1     2-0244-003chr13:
72560765-72560765
CAintergenicDe novo--Yuen2017 G
DACH1     1-0763-004chr13:
72243162-72243162
GCintronicDe novo--Yuen2017 G
DACH1     3-0080-000chr13:
72806853-72806853
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
DACH1     AU018010chr13:
72576883-72576883
CTintergenicDe novo--Yuen2017 G
DACH1     2-1406-003chr13:
72281154-72281154
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DACH1     2-1511-003chr13:
73230494-73230509
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
DACH1     2-1291-003chr13:
73210716-73210716
AGintergenicDe novo--Yuen2017 G
DACH1     AU3263301chr13:
73041967-73041967
TCintergenicDe novo--Yuen2017 G
DACH1     1-0627-007chr13:
72867996-72867996
CTintergenicDe novo--Yuen2017 G
DACH1     2-1322-004chr13:
73098091-73098091
CTintergenicDe novo--Yuen2017 G
DACH1     2-1342-003chr13:
72383554-72383554
CTintronicDe novo--Yuen2016 G
Yuen2017 G
DACH1     2-1386-003chr13:
72793899-72793899
ATintergenicDe novo--Yuen2016 G
Yuen2017 G
DACH1     A12chr13:
73075556-73075556
AGintergenicDe novo--Wu2018 G
DACH1     2-1645-003chr13:
72606987-72606987
TCintergenicDe novo--Yuen2017 G
DACH1     1-0010-005chr13:
72866043-72866043
CTintergenicDe novo--Yuen2017 G
DACH1     5-0025-003chr13:
72913083-72913083
CTintergenicDe novo--Yuen2017 G
DACH1     2-0132-004chr13:
72588100-72588100
TAintergenicDe novo--Yuen2017 G
DACH1     AU3777301chr13:
72920080-72920080
GAintergenicDe novo--Yuen2017 G
DACH1     AU059903chr13:
72228600-72228600
AGintronicDe novo--Yuen2017 G
DACH1     1-0325-003chr13:
72643912-72643912
TCintergenicDe novo--Yuen2017 G
DACH1     1-0200-004chr13:
72104731-72104731
TCintronicDe novo--Yuen2017 G
DACH1     1-0150-003chr13:
72483034-72483034
GTintergenicDe novo--Yuen2017 G
DACH1     2-0127-004chr13:
73198360-73198360
AGintergenicDe novo--Yuen2017 G
DACH1     1-0186-005chr13:
72771955-72771955
ACintergenicDe novo--Yuen2017 G
DACH1     1-0585-003chr13:
72841221-72841221
CTintergenicDe novo--Yuen2017 G
DACH1     7-0082-003chr13:
73126640-73126642
AGCAintergenicDe novo--Yuen2017 G
DACH1     1-0636-003chr13:
73260172-73260175
TCCATCCACCAintergenicDe novo--Yuen2017 G
DACH1     1-0986-003chr13:
72973196-72973196
AGintergenicDe novo--Yuen2017 G
DACH1     1-0121-003chr13:
73103987-73103987
GTintergenicDe novo--Yuen2017 G
DACH1     2-1369-003chr13:
72339175-72339175
TCintronicDe novo--Yuen2016 G
Yuen2017 G
DACH1     5-0071-003chr13:
72734690-72734690
CTintergenicDe novo--Yuen2017 G
DACH1     AU4145303chr13:
72792092-72792092
ACintergenicDe novo--Yuen2017 G
DACH1     1-0375-003chr13:
72552621-72552621
TCintergenicDe novo--Yuen2016 G
DACH1     2-0323-003chr13:
72960514-72960514
TCintergenicDe novo--Yuen2017 G
DACH1     AU4029301chr13:
72116107-72116107
CTintronicDe novo--Yuen2017 G
DACH1     AU074403chr13:
73227770-73227777
AAAAAAATAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More