or
or
Exact

Results for "SMARCA4"

Variant Events: 35

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SMARCA4     AU4234303chr19:
11084646-11084646
TGintronicDe novo--Trost2022 G
Yuen2017 G
SMARCA4     1-0259-005chr19:
11138480-11138480
CTexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C3236T
c.C3236T
c.C3236T
c.C3236T
c.C3236T
c.C3236T
c.C3236T
p.S1079L
p.S1079L
p.S1079L
p.S1079L
p.S1079L
p.S1079L
p.S1079L
32.0-Trost2022 G
Yuen2017 G
Zhou2022 GE
SMARCA4     1026chr19:
11132500-11132500
CTexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C2716T
c.C2716T
c.C2716T
c.C2716T
c.C2716T
c.C2716T
c.C2716T
p.R906C
p.R906C
p.R906C
p.R906C
p.R906C
p.R906C
p.R906C
15.21-Antaki2022 GE
Trost2022 G
Zhou2022 GE
SMARCA4     Hu2022:34chr19:
11105513-11105513
AGexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.A1429G
c.A1429G
c.A1429G
c.A1429G
c.A1429G
c.A1429G
c.A1429G
p.N477D
p.N477D
p.N477D
p.N477D
p.N477D
p.N477D
p.N477D
21.9-Hu2022 T
SMARCA4     MT_22.3chr19:
11101945-11101945
GTexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.G1365T
c.G1365T
c.G1365T
c.G1365T
c.G1365T
c.G1365T
c.G1365T
p.K455N
p.K455N
p.K455N
p.K455N
p.K455N
p.K455N
p.K455N
20.2-Antaki2022 GE
Trost2022 G
Zhou2022 GE
SMARCA4     1-0169-003chr19:
11163512-11163512
AGintronicDe novo--Trost2022 G
Yuen2017 G
SMARCA4     SP0033566chr19:
11150229-11150231
GGTGsplicingInheritedsplicing--Feliciano2019 E
SMARCA4     13551.p1chr19:
11170557-11170557
CTexonicsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_003072
NM_001128844
NM_001128849
c.C4674T
c.C4671T
c.C4665T
c.C4662T
c.C4764T
c.C4764T
c.C4860T
p.S1558S
p.S1557S
p.S1555S
p.S1554S
p.S1588S
p.S1588S
p.S1620S
-5.043E-5Zhou2022 GE
SMARCA4     SP0049284chr19:
11129654-11129654
CTexonicsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C2460T
c.C2460T
c.C2460T
c.C2460T
c.C2460T
c.C2460T
c.C2460T
p.Y820Y
p.Y820Y
p.Y820Y
p.Y820Y
p.Y820Y
p.Y820Y
p.Y820Y
-8.237E-5Zhou2022 GE
SMARCA4     Lo2022:16chr19:
11094897-11094897
CGexonicPaternalnonsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C70G
c.C70G
c.C70G
c.C70G
c.C70G
c.C70G
c.C70G
p.P24A
p.P24A
p.P24A
p.P24A
p.P24A
p.P24A
p.P24A
19.73-Lo2022 T
SMARCA4     SP0253577chr19:
11141587-11141587
CTintronicDe novo--Trost2022 G
SMARCA4     SJD_8.4chr19:
11142358-11142358
ATintronicDe novo--Trost2022 G
SMARCA4     SP0209250chr19:
11130306-11130306
CTexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C2545T
c.C2545T
c.C2545T
c.C2545T
c.C2545T
c.C2545T
c.C2545T
p.R849W
p.R849W
p.R849W
p.R849W
p.R849W
p.R849W
p.R849W
15.96-Trost2022 G
SMARCA4     SP0211886chr19:
11138468-11138468
TCexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.T3224C
c.T3224C
c.T3224C
c.T3224C
c.T3224C
c.T3224C
c.T3224C
p.L1075P
p.L1075P
p.L1075P
p.L1075P
p.L1075P
p.L1075P
p.L1075P
21.0-Trost2022 G
SMARCA4     1-1034-003chr19:
11121441-11121441
GAintronicDe novo--Trost2022 G
SMARCA4     Lo2022:17chr19:
11097111-11097111
ATexonicPaternalnonsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.A602T
c.A602T
c.A602T
c.A602T
c.A602T
c.A602T
c.A602T
p.Q201L
p.Q201L
p.Q201L
p.Q201L
p.Q201L
p.Q201L
p.Q201L
22.64.0E-4Lo2022 T
SMARCA4     7-0105-003chr19:
11123977-11123977
AGintronicDe novo--Trost2022 G
SMARCA4     Miyake2023:11181chr19:
11152025-11152025
CTexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_003072
NM_001128844
NM_001128849
c.C4123T
c.C4123T
c.C4114T
c.C4114T
c.C4213T
c.C4213T
c.C4309T
p.R1375W
p.R1375W
p.R1372W
p.R1372W
p.R1405W
p.R1405W
p.R1437W
28.5-Miyake2023 E
SMARCA4     MSSNG00433-003chr19:
11071380-11071380
GCupstreamDe novo--Trost2022 G
SMARCA4     2-1781-003chr19:
11076413-11076413
CTintronicDe novo--Trost2022 G
SMARCA4     NDAR_INVJF959YMH_wes1chr19:
11096936-11096936
CGexonicMosaicnonsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C427G
c.C427G
c.C427G
c.C427G
c.C427G
c.C427G
c.C427G
p.P143A
p.P143A
p.P143A
p.P143A
p.P143A
p.P143A
p.P143A
14.8-Lim2017 E
SMARCA4     GEA378chr19:
11170480-11170480
AGexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_003072
NM_001128844
NM_001128849
c.A4597G
c.A4594G
c.A4588G
c.A4585G
c.A4687G
c.A4687G
c.A4783G
p.K1533E
p.K1532E
p.K1530E
p.K1529E
p.K1563E
p.K1563E
p.K1595E
13.46-Fu2022 E
SMARCA4     A170295chr19:
11144499-11144499
GAexonicDe novosynonymous SNVNM_001128849
NM_003072
NM_001128844
c.G3831A
c.G3831A
c.G3831A
p.P1277P
p.P1277P
p.P1277P
-1.753E-5Fu2022 E
SMARCA4     7-0332-003chr19:
11146423-11146423
CTintronicDe novo--Trost2022 G
SMARCA4     mAGRE4739chr19:
11100073-11100073
CTexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C1199T
c.C1199T
c.C1199T
c.C1199T
c.C1199T
c.C1199T
c.C1199T
p.A400V
p.A400V
p.A400V
p.A400V
p.A400V
p.A400V
p.A400V
33.0-Cirnigliaro2023 G
SMARCA4     5-0046-003chr19:
11154288-11154288
CGintronicDe novo--Trost2022 G
SMARCA4     14482.p1chr19:
11141434-11141434
GGAACGGCCCGTTGGCATCGAGCCGCCGGCGCGCGGTTTCGAGCACexonicDe novoframeshift insertionNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.3411_3412insAACGGCCCGTTGGCATCGAGCCGCCGGCGCGCGGTTTCGAGCAC
c.3411_3412insAACGGCCCGTTGGCATCGAGCCGCCGGCGCGCGGTTTCGAGCAC
c.3411_3412insAACGGCCCGTTGGCATCGAGCCGCCGGCGCGCGGTTTCGAGCAC
c.3411_3412insAACGGCCCGTTGGCATCGAGCCGCCGGCGCGCGGTTTCGAGCAC
c.3411_3412insAACGGCCCGTTGGCATCGAGCCGCCGGCGCGCGGTTTCGAGCAC
c.3411_3412insAACGGCCCGTTGGCATCGAGCCGCCGGCGCGCGGTTTCGAGCAC
c.3411_3412insAACGGCCCGTTGGCATCGAGCCGCCGGCGCGCGGTTTCGAGCAC
p.M1137fs
p.M1137fs
p.M1137fs
p.M1137fs
p.M1137fs
p.M1137fs
p.M1137fs
--Lowther2023 G
SMARCA4     1-1018-003chr19:
11145065-11145065
GAintronicDe novo--Trost2022 G
SMARCA4     MSSNG00436-003chr19:
11145419-11145419
GAintronicDe novo--Trost2022 G
SMARCA4     DEASD_0072_001chr19:
11096052-11096052
CTexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C326T
c.C326T
c.C326T
c.C326T
c.C326T
c.C326T
c.C326T
p.P109L
p.P109L
p.P109L
p.P109L
p.P109L
p.P109L
p.P109L
32.08.409E-6DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SMARCA4     DEASD_0150_001chr19:
11097060-11097060
TCexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.T551C
c.T551C
c.T551C
c.T551C
c.T551C
c.T551C
c.T551C
p.I184T
p.I184T
p.I184T
p.I184T
p.I184T
p.I184T
p.I184T
22.8-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
SMARCA4     Mahjani2021:68chr19:
11144847-11144847
CTexonicnonsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.C3823T
c.C3823T
c.C3823T
c.C3823T
c.C3922T
c.C3922T
c.C3922T
p.R1275W
p.R1275W
p.R1275W
p.R1275W
p.R1308W
p.R1308W
p.R1308W
19.3-Mahjani2021 E
SMARCA4     Mahjani2021:61chr19:
11123787-11123787
TGexonicnonsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_001128849
NM_003072
NM_001128844
c.T2437G
c.T2437G
c.T2437G
c.T2437G
c.T2437G
c.T2437G
c.T2437G
p.S813A
p.S813A
p.S813A
p.S813A
p.S813A
p.S813A
p.S813A
27.8-Mahjani2021 E
SMARCA4     G01_GEA530HIchr19:
11145450-11145450
GTintronicDe novo--Fu2022 E
SMARCA4     NP115chr19:
11152025-11152025
CTexonicDe novononsynonymous SNVNM_001128845
NM_001128846
NM_001128847
NM_001128848
NM_003072
NM_001128844
NM_001128849
c.C4123T
c.C4123T
c.C4114T
c.C4114T
c.C4213T
c.C4213T
c.C4309T
p.R1375W
p.R1375W
p.R1372W
p.R1372W
p.R1405W
p.R1405W
p.R1437W
28.5-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More