or
or
Exact

Results for "Cirnigliaro2023"

Variant Events: 13590

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TRIM66     AU2075301chr11:
8673346-8673346
CTsplicingDe novosplicing22.3-Cirnigliaro2023 G
F2     AU2075302chr11:
46751076-46751076
CTexonicDe novononsynonymous SNVNM_000506
NM_001311257
c.C1619T
c.C1571T
p.T540I
p.T524I
28.1-Cirnigliaro2023 G
RAPGEF4     AU2139303chr2:
173832154-173832154
GAexonicDe novononsynonymous SNVNM_001282901
NM_001282900
NM_001100397
NM_001282899
NM_007023
c.G326A
c.G473A
c.G554A
c.G527A
c.G986A
p.R109K
p.R158K
p.R185K
p.R176K
p.R329K
21.0-Cirnigliaro2023 G
XPO5     AU2248302chr6:
43492367-43492367
TCexonicDe novononsynonymous SNVNM_020750c.A3319Gp.R1107G23.3-Cirnigliaro2023 G
AGO3     AU2410302chr1:
36475161-36475161
CAexonicDe novononsynonymous SNVNM_177422
NM_024852
c.C413A
c.C1115A
p.S138Y
p.S372Y
28.5-Cirnigliaro2023 G
PHF3     AU2427301chr6:
64413519-64413523
CACAGCexonicDe novoframeshift deletionNM_015153
NM_001290259
c.3326_3329del
c.3062_3065del
p.H1109fs
p.H1021fs
--Cirnigliaro2023 G
ZNF668     AU2793302chr16:
31073434-31073434
CTexonicDe novononsynonymous SNVNM_001172668
NM_001172670
NM_024706
NM_001172669
c.G815A
c.G815A
c.G815A
c.G884A
p.R272H
p.R272H
p.R272H
p.R295H
29.2-Cirnigliaro2023 G
PLEKHN1     mAGRE1029chr1:
905962-905962
CAexonicMaternalstopgainNM_001160184
NM_032129
c.C392A
c.C392A
p.S131X
p.S131X
18.488.387E-6Cirnigliaro2023 G
SAMD11     mAGRE5023chr1:
878759-878759
TCsplicingPaternalsplicing10.8-Cirnigliaro2023 G
SAMD11     mAGRE5022chr1:
878759-878759
TCsplicingPaternalsplicing10.8-Cirnigliaro2023 G
TTLL10     mAGRE2136chr1:
1119472-1119472
GCsplicingPaternalsplicing13.73-Cirnigliaro2023 G
TTLL10     mAGRE4668chr1:
1118423-1118423
CTexonicPaternalstopgainNM_153254
NM_001130045
c.C865T
c.C1084T
p.Q289X
p.Q362X
27.63.2E-5Cirnigliaro2023 G
TTLL10     mAGRE4432chr1:
1114650-1114650
CTexonicMaternalstopgainNM_001130045c.C55Tp.R19X32.02.0E-4Cirnigliaro2023 G
AGRN     mAGRE2565chr1:
977058-977105
CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGGCexonicMaternalnonframeshift deletionNM_198576c.1154_1177delp.385_393del-1.0E-4Cirnigliaro2023 G
AGRN     mAGRE2564chr1:
977058-977105
CGCTCCGGCCAGTGCCAGGGTCGAGGTGAGCGGCTCCCCCGGGGGAGGCexonicMaternalnonframeshift deletionNM_198576c.1154_1177delp.385_393del-1.0E-4Cirnigliaro2023 G
ISG15     mAGRE4409chr1:
949392-949393
CGCexonicMaternalframeshift deletionNM_005101c.33delGp.A11fs--Cirnigliaro2023 G
HES4     mAGRE4080chr1:
935239-935240
ACAexonicPaternalframeshift deletionNM_001142467c.114delGp.G38fs--Cirnigliaro2023 G
PLEKHN1     mAGRE5723chr1:
906784-906784
GGGTGGGCCCCTCCCCACTexonicMaternalframeshift insertionNM_001160184
NM_032129
c.825_826insGTGGGCCCCTCCCCACT
c.789_790insGTGGGCCCCTCCCCACT
p.K275fs
p.K263fs
-3.136E-5Cirnigliaro2023 G
PUSL1     AU3794301chr1:
1244293-1244293
AGsplicingPaternalsplicing8.0322.0E-4Cirnigliaro2023 G
SCNN1D     mAGRE2854chr1:
1226836-1226840
CCAGTCexonicPaternalframeshift deletionNM_001130413c.2256_2259delp.A752fs-1.919E-5Cirnigliaro2023 G
SCNN1D     mAGRE2853chr1:
1226836-1226840
CCAGTCexonicPaternalframeshift deletionNM_001130413c.2256_2259delp.A752fs-1.919E-5Cirnigliaro2023 G
SCNN1D     mAGRE2868chr1:
1226018-1226018
GTexonicMaternalstopgainNM_001130413c.G1861Tp.E621X43.0-Cirnigliaro2023 G
SCNN1D     mAGRE4228chr1:
1221015-1221015
CTexonicMaternalstopgainNM_001130413c.C529Tp.Q177X11.11-Cirnigliaro2023 G
C1QTNF12     mAGRE4571chr1:
1179389-1179396
TGCAGCCGTexonicMaternalframeshift deletionNM_001014980c.469_475delp.R157fs--Cirnigliaro2023 G
SDF4     mAGRE4135chr1:
1167270-1167270
AGsplicingPaternalsplicing--Cirnigliaro2023 G
SDF4     mAGRE4134chr1:
1167270-1167270
AGsplicingPaternalsplicing--Cirnigliaro2023 G
VWA1     mAGRE2701chr1:
1372740-1372753
CACCGGCCGAGGCACexonicPaternalframeshift deletionNM_022834
NM_199121
c.508_520del
c.113_125del
p.T170fs
p.H38fs
--Cirnigliaro2023 G
CPTP     mAGRE5134chr1:
1262797-1262797
AACexonicMaternalframeshift insertionNM_001029885c.300dupCp.H100fs--Cirnigliaro2023 G
INTS11     AU4032305chr1:
1256453-1256453
GAexonicMaternalstopgainNM_001256463
NM_017871
NM_001256456
c.C49T
c.C49T
c.C67T
p.R17X
p.R17X
p.R23X
36.04.204E-5Cirnigliaro2023 G
INTS11     mAGRE3207chr1:
1248413-1248413
AGsplicingPaternalsplicing8.586-Cirnigliaro2023 G
INTS11     AU3859301chr1:
1248413-1248413
AGsplicingPaternalsplicing8.586-Cirnigliaro2023 G
PUSL1     mAGRE3207chr1:
1246287-1246293
AGGTACGAexonicMaternalframeshift deletionNM_153339c.700_704delp.V234fs--Cirnigliaro2023 G
PUSL1     AU3859301chr1:
1246287-1246293
AGGTACGAexonicMaternalframeshift deletionNM_153339c.700_704delp.V234fs--Cirnigliaro2023 G
PUSL1     mAGRE5308chr1:
1244581-1244581
CGexonicMaternalstopgainNM_153339c.C251Gp.S84X16.167.484E-5Cirnigliaro2023 G
PEX10     mAGRE2136chr1:
2341891-2341891
CTsplicingPaternalsplicing10.56-Cirnigliaro2023 G
PEX10     mAGRE1910chr1:
2338205-2338205
GAexonicPaternalstopgainNM_002617
NM_153818
c.C730T
c.C790T
p.R244X
p.R264X
17.052.221E-5Cirnigliaro2023 G
ATAD3B     mAGRE4436chr1:
1421968-1421968
CCGexonicPaternalframeshift insertionNM_001317238
NM_031921
c.997dupG
c.1135dupG
p.G332fs
p.G378fs
--Cirnigliaro2023 G
ATAD3B     mAGRE1713chr1:
1407404-1407404
GAexonicMaternalstopgainNM_031921c.G140Ap.W47X38.0-Cirnigliaro2023 G
ATAD3C     AU3997302chr1:
1391177-1391177
CCTexonicPaternalframeshift insertionNM_001039211c.446dupTp.L149fs-8.395E-6Cirnigliaro2023 G
ATAD3C     AU3997301chr1:
1391177-1391177
CCTexonicPaternalframeshift insertionNM_001039211c.446dupTp.L149fs-8.395E-6Cirnigliaro2023 G
ATAD3C     mAGRE5442chr1:
1387503-1387503
GAsplicingPaternalsplicing5.0271.747E-5Cirnigliaro2023 G
VWA1     mAGRE2623chr1:
1375090-1375104
ACGCCCGACGGCCCGAexonicMaternalframeshift deletionNM_022834c.1262_1275delp.T421fs--Cirnigliaro2023 G
MMEL1     mAGRE2033chr1:
2526245-2526245
TAexonicMaternalstopgainNM_033467c.A1672Tp.K558X38.04.152E-5Cirnigliaro2023 G
MMEL1     mAGRE2032chr1:
2526245-2526245
TAexonicMaternalstopgainNM_033467c.A1672Tp.K558X38.04.152E-5Cirnigliaro2023 G
FAM213B     mAGRE2799chr1:
2520016-2520020
TTGTCTexonicMaternalframeshift deletionNM_001195736
NM_001195737
NM_001195738
NM_152371
c.557_560del
c.523_526del
c.503_506del
c.503_506del
p.L186fs
p.C175fs
p.L168fs
p.L168fs
-4.0E-4Cirnigliaro2023 G
FAM213B     mAGRE2415chr1:
2518246-2518247
GCGexonicMaternalframeshift deletionNM_001195736
NM_001195737
NM_001195738
NM_001195740
NM_001195741
NM_152371
c.13delC
c.13delC
c.13delC
c.13delC
c.13delC
c.13delC
p.R5fs
p.R5fs
p.R5fs
p.R5fs
p.R5fs
p.R5fs
--Cirnigliaro2023 G
PLCH2     AU4069302chr1:
2426924-2426927
CAGACexonicPaternalframeshift deletionNM_001303012
NM_001303013
NM_014638
c.1672_1672del
c.1813_1813del
c.1753_1753del
p.K558fs
p.K605fs
p.K585fs
--Cirnigliaro2023 G
PLCH2     AU4069301chr1:
2426924-2426927
CAGACexonicPaternalframeshift deletionNM_001303012
NM_001303013
NM_014638
c.1672_1672del
c.1813_1813del
c.1753_1753del
p.K558fs
p.K605fs
p.K585fs
--Cirnigliaro2023 G
PLCH2     mAGRE1302chr1:
2411251-2411252
ACAexonicPaternalframeshift deletionNM_001303012
NM_001303013
NM_014638
c.270delC
c.411delC
c.351delC
p.D90fs
p.D137fs
p.D117fs
-2.631E-5Cirnigliaro2023 G
PEX10     mAGRE1401chr1:
2343913-2343913
TTGexonicPaternalframeshift insertionNM_002617
NM_153818
c.28_29insC
c.28_29insC
p.E10fs
p.E10fs
--Cirnigliaro2023 G
MEGF6     mAGRE5887chr1:
3413551-3413551
CTsplicingMaternalsplicing12.176.0E-4Cirnigliaro2023 G
ARHGEF16     mAGRE1992chr1:
3394591-3394591
GCsplicingPaternalsplicing15.044.171E-5Cirnigliaro2023 G
ARHGEF16     mAGRE1991chr1:
3394591-3394591
GCsplicingPaternalsplicing15.044.171E-5Cirnigliaro2023 G
ARHGEF16     AU2248302chr1:
3382719-3382719
TTGexonicMaternalframeshift insertionNM_014448c.597dupGp.L199fs-1.0E-4Cirnigliaro2023 G
ARHGEF16     mAGRE1191chr1:
3371372-3371389
GCAGGTGAGCCTGGGGGAGUTR5Maternal--Cirnigliaro2023 G
MMEL1     mAGRE2854chr1:
2537686-2537686
CTsplicingPaternalsplicing14.081.664E-5Cirnigliaro2023 G
MMEL1     mAGRE2853chr1:
2537686-2537686
CTsplicingPaternalsplicing14.081.664E-5Cirnigliaro2023 G
MMEL1     mAGRE2193chr1:
2526245-2526245
TAexonicPaternalstopgainNM_033467c.A1672Tp.K558X38.04.152E-5Cirnigliaro2023 G
NPHP4     mAGRE2463chr1:
5927859-5927863
TGATATexonicPaternalframeshift deletionNM_001291594
NM_001291593
NM_015102
c.1873_1876del
c.1870_1873del
c.3409_3412del
p.Y625fs
p.Y624fs
p.Y1137fs
-8.311E-6Cirnigliaro2023 G
DFFB     mAGRE6059chr1:
3784608-3784608
CGexonicPaternalstopgainNM_001282669
NM_004402
c.C573G
c.C501G
p.Y191X
p.Y167X
38.08.236E-6Cirnigliaro2023 G
LRRC47     mAGRE5489chr1:
3712590-3712592
AGCAexonicMaternalframeshift deletionNM_020710c.449_450delp.R150fs--Cirnigliaro2023 G
CCDC27     AU1795301chr1:
3688024-3688024
GGCexonicPaternalframeshift insertionNM_152492c.1909dupCp.V636fs-1.0E-4Cirnigliaro2023 G
CCDC27     mAGRE1777chr1:
3680362-3680362
CTexonicMaternalstopgainNM_152492c.C1414Tp.R472X26.54.0E-4Cirnigliaro2023 G
CCDC27     mAGRE1867chr1:
3669283-3669283
TTGCCCAGAATGGAAACCexonicPaternalframeshift insertionNM_152492c.238_239insGCCCAGAATGGAAACCp.C80fs--Cirnigliaro2023 G
WRAP73     mAGRE4402chr1:
3563273-3563273
CTexonicMaternalstopgainNM_017818c.G296Ap.W99X28.3-Cirnigliaro2023 G
MEGF6     mAGRE4198chr1:
3431237-3431237
CAsplicingMaternalsplicing10.3-Cirnigliaro2023 G
KLHL21     mAGRE2687chr1:
6653457-6653457
GGGGGTCGGCCTexonicPaternalframeshift insertionNM_014851c.1761_1762insAGGCCGACCCp.R588fs--Cirnigliaro2023 G
NOL9     mAGRE1080chr1:
6604909-6604909
GCexonicPaternalstopgainNM_024654c.C954Gp.Y318X37.0-Cirnigliaro2023 G
GPR153     mAGRE2553chr1:
6309521-6309521
CTexonicMaternalstopgainNM_207370c.G1707Ap.W569X37.0-Cirnigliaro2023 G
CHD5     mAGRE2831chr1:
6166453-6166453
AGsplicingMaternalsplicing21.9-Cirnigliaro2023 G
NPHP4     mAGRE4876chr1:
5987793-5987793
CAexonicPaternalstopgainNM_015102c.G1357Tp.E453X38.0-Cirnigliaro2023 G
NPHP4     AU3154302chr1:
5969253-5969253
GAexonicPaternalstopgainNM_015102c.C1462Tp.R488X37.01.0E-4Cirnigliaro2023 G
NPHP4     AU3154301chr1:
5969253-5969253
GAexonicPaternalstopgainNM_015102c.C1462Tp.R488X37.01.0E-4Cirnigliaro2023 G
NPHP4     mAGRE4786chr1:
5967174-5967174
CTsplicingPaternalsplicing9.936-Cirnigliaro2023 G
PER3     AU3154302chr1:
7870615-7870636
CCGAATGGTGGTGGTGAGTCAGCexonicMaternalnonframeshift deletionNM_001289861
NM_001289862
NM_001289863
NM_001289864
NM_016831
c.1490_1510del
c.1490_1510del
c.1490_1501del
c.533_553del
c.1487_1498del
p.497_504del
p.497_504del
p.497_501del
p.178_185del
p.496_500del
-2.0E-4Cirnigliaro2023 G
PER3     AU3154301chr1:
7870615-7870636
CCGAATGGTGGTGGTGAGTCAGCexonicMaternalnonframeshift deletionNM_001289861
NM_001289862
NM_001289863
NM_001289864
NM_016831
c.1490_1510del
c.1490_1510del
c.1490_1501del
c.533_553del
c.1487_1498del
p.497_504del
p.497_504del
p.497_501del
p.178_185del
p.496_500del
-2.0E-4Cirnigliaro2023 G
PER3     mAGRE1854chr1:
7845566-7845571
ACTTCCAexonicMaternalframeshift deletionNM_001289861
NM_001289862
NM_001289863
NM_016831
c.195_199del
c.195_199del
c.195_199del
c.195_199del
p.Y65fs
p.Y65fs
p.Y65fs
p.Y65fs
--Cirnigliaro2023 G
THAP3     mAGRE6047chr1:
6693057-6693057
CTexonicMaternalstopgainNM_001195752
NM_001195753
c.C637T
c.C640T
p.R213X
p.R214X
16.584.576E-5Cirnigliaro2023 G
THAP3     mAGRE6046chr1:
6693057-6693057
CTexonicMaternalstopgainNM_001195752
NM_001195753
c.C637T
c.C640T
p.R213X
p.R214X
16.584.576E-5Cirnigliaro2023 G
KLHL21     AU3649305chr1:
6662350-6662350
CCAexonicMaternalframeshift insertionNM_014851c.527dupTp.L176fs--Cirnigliaro2023 G
KLHL21     AU3649304chr1:
6662350-6662350
CCAexonicMaternalframeshift insertionNM_014851c.527dupTp.L176fs--Cirnigliaro2023 G
KLHL21     mAGRE1183chr1:
6662231-6662231
TTGCGCGexonicMaternalframeshift insertionNM_014851c.646_647insCGCGCp.H216fs--Cirnigliaro2023 G
MASP2     mAGRE2049chr1:
11087545-11087545
ATexonicPaternalstopgainNM_006610c.T1458Ap.Y486X10.768.236E-6Cirnigliaro2023 G
C1orf127     mAGRE1758chr1:
11015136-11015136
GAexonicPaternalstopgainNM_001170754c.C886Tp.R296X17.523.295E-5Cirnigliaro2023 G
DFFA     mAGRE1837chr1:
10527391-10527391
TCsplicingPaternalsplicing16.73-Cirnigliaro2023 G
CORT     mAGRE5746chr1:
10511433-10511433
GAsplicingPaternalsplicing16.334.599E-5Cirnigliaro2023 G
H6PD     mAGRE1424chr1:
9322320-9322320
CGexonicPaternalstopgainNM_001282587
NM_004285
c.C981G
c.C948G
p.Y327X
p.Y316X
36.03.243E-5Cirnigliaro2023 G
RERE     mAGRE5377chr1:
8420839-8420839
GAexonicDe novostopgainNM_001042682
NM_001042681
NM_012102
c.C1066T
c.C2728T
c.C2728T
p.Q356X
p.Q910X
p.Q910X
37.0-Cirnigliaro2023 G
PER3     AU4007301chr1:
7886771-7886771
GTsplicingPaternalsplicing13.041.944E-5Cirnigliaro2023 G
PER3     AU3905301chr1:
7870615-7870636
CCGAATGGTGGTGGTGAGTCAGCexonicPaternalnonframeshift deletionNM_001289861
NM_001289862
NM_001289863
NM_001289864
NM_016831
c.1490_1510del
c.1490_1510del
c.1490_1501del
c.533_553del
c.1487_1498del
p.497_504del
p.497_504del
p.497_501del
p.178_185del
p.496_500del
-2.0E-4Cirnigliaro2023 G
DRAXIN     mAGRE1440chr1:
11771907-11771907
GCsplicingMaternalsplicing2.9214.489E-5Cirnigliaro2023 G
UBIAD1     AU3787303chr1:
11333688-11333688
CTexonicMaternalstopgainNM_013319c.C100Tp.Q34X29.3-Cirnigliaro2023 G
UBIAD1     AU3787302chr1:
11333688-11333688
CTexonicMaternalstopgainNM_013319c.C100Tp.Q34X29.3-Cirnigliaro2023 G
ANGPTL7     mAGRE2116chr1:
11253722-11253722
GAexonicPaternalstopgainNM_021146c.G563Ap.W188X40.03.0E-4Cirnigliaro2023 G
MTOR     mAGRE1624chr1:
11187739-11187739
GAexonicDe novononsynonymous SNVNM_004958c.C6158Tp.P2053L29.9-Cirnigliaro2023 G
MASP2     mAGRE2420chr1:
11106783-11106783
GTexonicMaternalstopgainNM_006610
NM_139208
c.C242A
c.C242A
p.S81X
p.S81X
26.25.57E-5Cirnigliaro2023 G
MASP2     AU2458303chr1:
11090923-11090923
AAGexonicPaternalframeshift insertionNM_006610c.1103dupCp.P368fs--Cirnigliaro2023 G
MASP2     mAGRE2051chr1:
11087545-11087545
ATexonicPaternalstopgainNM_006610c.T1458Ap.Y486X10.768.236E-6Cirnigliaro2023 G
PLOD1     mAGRE6018chr1:
12025599-12025599
CGexonicPaternalstopgainNM_000302
NM_001316320
c.C1533G
c.C1674G
p.Y511X
p.Y558X
27.01.66E-5Cirnigliaro2023 G
PLOD1     mAGRE6017chr1:
12025599-12025599
CGexonicPaternalstopgainNM_000302
NM_001316320
c.C1533G
c.C1674G
p.Y511X
p.Y558X
27.01.66E-5Cirnigliaro2023 G
NPPB     mAGRE2467chr1:
11918337-11918337
GAexonicPaternalstopgainNM_002521c.C322Tp.Q108X16.478.311E-6Cirnigliaro2023 G
NPPA     mAGRE5466chr1:
11907390-11907391
AGAexonicMaternalframeshift deletionNM_006172c.229delCp.L77fs-8.352E-6Cirnigliaro2023 G
NPPA     mAGRE5465chr1:
11907390-11907391
AGAexonicMaternalframeshift deletionNM_006172c.229delCp.L77fs-8.352E-6Cirnigliaro2023 G
CLCN6     mAGRE5526chr1:
11897399-11897399
GCsplicingMaternalsplicing28.28.304E-6Cirnigliaro2023 G
DRAXIN     mAGRE4995chr1:
11779639-11779639
AGsplicingMaternalsplicing14.326.143E-5Cirnigliaro2023 G
DRAXIN     mAGRE4994chr1:
11779639-11779639
AGsplicingMaternalsplicing14.326.143E-5Cirnigliaro2023 G
DHRS3     mAGRE1568chr1:
12677176-12677176
CAexonicMaternalstopgainNM_004753c.G178Tp.E60X41.0-Cirnigliaro2023 G
VPS13D     mAGRE1571chr1:
12463986-12463988
TAATexonicMaternalframeshift deletionNM_018156
NM_015378
c.11916_11917del
c.11991_11992del
p.L3972fs
p.L3997fs
--Cirnigliaro2023 G
VPS13D     mAGRE2440chr1:
12428551-12428551
CTexonicPaternalstopgainNM_018156
NM_015378
c.C10402T
c.C10477T
p.R3468X
p.R3493X
53.0-Cirnigliaro2023 G
VPS13D     mAGRE5386chr1:
12379689-12379689
TAsplicingMaternalsplicing29.3-Cirnigliaro2023 G
VPS13D     mAGRE5385chr1:
12379689-12379689
TAsplicingMaternalsplicing29.3-Cirnigliaro2023 G
MIIP     mAGRE6143chr1:
12082195-12082195
CAexonicPaternalstopgainNM_021933c.C158Ap.S53X17.173.0E-4Cirnigliaro2023 G
MIIP     AU3786301chr1:
12082195-12082195
CAexonicPaternalstopgainNM_021933c.C158Ap.S53X17.173.0E-4Cirnigliaro2023 G
MFN2     mAGRE3127chr1:
12061527-12061527
CTexonicPaternalstopgainNM_001127660
NM_014874
c.C886T
c.C886T
p.Q296X
p.Q296X
38.0-Cirnigliaro2023 G
FHAD1     mAGRE1685chr1:
15714546-15714546
GAintronicPaternal10.62-Cirnigliaro2023 G
FHAD1     mAGRE5400chr1:
15684640-15684640
TAexonicPaternalstopgainNM_052929c.T2531Ap.L844X17.95-Cirnigliaro2023 G
PRDM2     AU2427302chr1:
14068588-14068588
CAexonicMaternalstopgainNM_001135610
NM_012231
NM_015866
c.C320A
c.C320A
c.C320A
p.S107X
p.S107X
p.S107X
46.0-Cirnigliaro2023 G
PRAMEF1     mAGRE2827chr1:
12854380-12854396
ATATACCTGAATAGTATAexonicMaternalframeshift deletionNM_023013c.605_620delp.I202fs--Cirnigliaro2023 G
C1orf158     mAGRE1252chr1:
12815677-12815677
CTexonicPaternalstopgainNM_152290c.C139Tp.Q47X16.822.0E-4Cirnigliaro2023 G
AADACL4     mAGRE5526chr1:
12726174-12726174
CTexonicPaternalstopgainNM_001013630c.C652Tp.Q218X14.472.471E-5Cirnigliaro2023 G
AADACL4     mAGRE3018chr1:
12725971-12725971
GCsplicingMaternalsplicing11.382.0E-4Cirnigliaro2023 G
AADACL4     mAGRE3017chr1:
12725971-12725971
GCsplicingMaternalsplicing11.382.0E-4Cirnigliaro2023 G
ARHGEF19     mAGRE2774chr1:
16535192-16535192
GAexonicPaternalstopgainNM_153213c.C358Tp.R120X34.04.31E-5Cirnigliaro2023 G
ARHGEF19     mAGRE2772chr1:
16535192-16535192
GAexonicPaternalstopgainNM_153213c.C358Tp.R120X34.04.31E-5Cirnigliaro2023 G
FBLIM1     mAGRE2442chr1:
16101479-16101479
CTexonicMaternalstopgainNM_001024215c.C1078Tp.R360X13.044.0E-4Cirnigliaro2023 G
SLC25A34     mAGRE2390chr1:
16065760-16065761
CTCexonicPaternalframeshift deletionNM_207348c.775delTp.W259fs-1.0E-4Cirnigliaro2023 G
SLC25A34     mAGRE2878chr1:
16064433-16064433
CTexonicPaternalstopgainNM_207348c.C388Tp.Q130X19.051.0E-4Cirnigliaro2023 G
SLC25A34     mAGRE2877chr1:
16064433-16064433
CTexonicPaternalstopgainNM_207348c.C388Tp.Q130X19.051.0E-4Cirnigliaro2023 G
PLEKHM2     mAGRE3017chr1:
16053893-16053893
CCGexonicPaternalframeshift insertionNM_015164c.1327dupGp.P442fs--Cirnigliaro2023 G
DNAJC16     mAGRE4184chr1:
15893593-15893593
GTsplicingMaternalsplicing19.0-Cirnigliaro2023 G
PADI4     mAGRE4151chr1:
17682620-17682626
AAGGTACAexonicPaternalframeshift deletionNM_012387c.1454_1455delp.K485fs--Cirnigliaro2023 G
PADI4     mAGRE4150chr1:
17682620-17682626
AAGGTACAexonicPaternalframeshift deletionNM_012387c.1454_1455delp.K485fs--Cirnigliaro2023 G
PADI3     mAGRE5023chr1:
17609340-17609340
GAsplicingMaternalsplicing14.47-Cirnigliaro2023 G
PADI1     mAGRE2565chr1:
17555441-17555441
AGsplicingMaternalsplicing14.99-Cirnigliaro2023 G
PADI1     mAGRE2564chr1:
17555441-17555441
AGsplicingMaternalsplicing14.99-Cirnigliaro2023 G
PADI2     mAGRE1403chr1:
17410317-17410317
GTexonicMaternalstopgainNM_007365c.C954Ap.Y318X39.0-Cirnigliaro2023 G
ATP13A2     mAGRE5104chr1:
17331312-17331325
CCAGGCTGGGGAAGCexonicPaternalframeshift deletionNM_001141973
NM_001141974
NM_022089
c.348_351del
c.348_351del
c.348_351del
p.S116fs
p.S116fs
p.S116fs
-1.664E-5Cirnigliaro2023 G
ATP13A2     mAGRE1212chr1:
17313566-17313567
AGAexonicPaternalframeshift deletionNM_001141974
NM_001141973
NM_022089
c.2925delC
c.3042delC
c.3057delC
p.G975fs
p.G1014fs
p.G1019fs
-1.0E-4Cirnigliaro2023 G
PQLC2     mAGRE2412chr1:
19653023-19653023
AGsplicingMaternalsplicing13.362.473E-5Cirnigliaro2023 G
ALDH4A1     mAGRE4432chr1:
19202820-19202821
TGTexonicPaternalframeshift deletionNM_001161504
NM_003748
NM_170726
c.1146delC
c.1326delC
c.1326delC
p.P382fs
p.P442fs
p.P442fs
-4.135E-5Cirnigliaro2023 G
TAS1R2     mAGRE5082chr1:
19184121-19184121
CAexonicMaternalstopgainNM_152232c.G187Tp.E63X13.83-Cirnigliaro2023 G
TAS1R2     mAGRE5042chr1:
19175895-19175895
GTexonicPaternalstopgainNM_152232c.C1407Ap.Y469X14.664.943E-5Cirnigliaro2023 G
TAS1R2     mAGRE4994chr1:
19166635-19166635
TAexonicMaternalstopgainNM_152232c.A1978Tp.K660X32.01.647E-5Cirnigliaro2023 G
KLHDC7A     mAGRE1704chr1:
18809147-18809147
CGexonicDe novononsynonymous SNVNM_152375c.C1672Gp.R558G17.35-Cirnigliaro2023 G
KLHDC7A     mAGRE4995chr1:
18807656-18807656
GTexonicUnknownstopgainNM_152375c.G181Tp.E61X24.72.599E-5Cirnigliaro2023 G
KLHDC7A     mAGRE4994chr1:
18807656-18807656
GTexonicUnknownstopgainNM_152375c.G181Tp.E61X24.72.599E-5Cirnigliaro2023 G
VWA5B1     mAGRE2747chr1:
20677349-20677349
GAsplicingMaternalsplicing12.0-Cirnigliaro2023 G
VWA5B1     mAGRE1829chr1:
20669778-20669780
GGCGexonicPaternalframeshift deletionNM_001039500c.2519_2520delp.G840fs--Cirnigliaro2023 G
PLA2G2D     mAGRE1739chr1:
20440660-20440660
GAexonicPaternalstopgainNM_012400c.C385Tp.R129X16.446.623E-5Cirnigliaro2023 G
PLA2G2D     mAGRE1738chr1:
20440660-20440660
GAexonicPaternalstopgainNM_012400c.C385Tp.R129X16.446.623E-5Cirnigliaro2023 G
OTUD3     mAGRE4192chr1:
20230892-20230892
GAsplicingPaternalsplicing12.911.679E-5Cirnigliaro2023 G
OTUD3     mAGRE3011chr1:
20230892-20230892
GAsplicingMaternalsplicing12.911.679E-5Cirnigliaro2023 G
TMCO4     mAGRE4172chr1:
20020980-20020980
GAexonicPaternalstopgainNM_181719c.C1447Tp.Q483X38.08.261E-6Cirnigliaro2023 G
PQLC2     mAGRE5784chr1:
19653023-19653023
AGsplicingMaternalsplicing13.362.473E-5Cirnigliaro2023 G
ALPL     mAGRE2537chr1:
21894597-21894597
GGCexonicMaternalframeshift insertionNM_001177520
NM_001127501
NM_000478
c.418_419insC
c.484_485insC
c.649_650insC
p.V140fs
p.V162fs
p.V217fs
-8.24E-6Cirnigliaro2023 G
ALPL     mAGRE2536chr1:
21894597-21894597
GGCexonicMaternalframeshift insertionNM_001177520
NM_001127501
NM_000478
c.418_419insC
c.484_485insC
c.649_650insC
p.V140fs
p.V162fs
p.V217fs
-8.24E-6Cirnigliaro2023 G
EIF4G3     mAGRE4180chr1:
21415708-21415708
TGsplicingPaternalsplicing15.52-Cirnigliaro2023 G
KIF17     mAGRE1199chr1:
21039945-21039945
ATsplicingPaternalsplicing19.28.561E-6Cirnigliaro2023 G
KIF17     mAGRE5716chr1:
20991094-20991095
CACexonicMaternalframeshift deletionNM_001122819
NM_001287212
NM_020816
c.3069delT
c.2772delT
c.3072delT
p.F1023fs
p.F924fs
p.F1024fs
--Cirnigliaro2023 G
PINK1     AU1795303chr1:
20960054-20960054
CTexonicUnknownstopgainNM_032409c.C13Tp.Q5X37.0-Cirnigliaro2023 G
MUL1     mAGRE1685chr1:
20827377-20827377
GAexonicMaternalstopgainNM_024544c.C865Tp.R289X16.463.302E-5Cirnigliaro2023 G
VWA5B1     mAGRE2748chr1:
20677349-20677349
GAsplicingMaternalsplicing12.0-Cirnigliaro2023 G
HSPG2     mAGRE3119chr1:
22178283-22178283
CTsplicingPaternalsplicing22.2-Cirnigliaro2023 G
HSPG2     mAGRE2382chr1:
22149892-22149892
GAexonicPaternalstopgainNM_001291860
NM_005529
c.C13096T
c.C13093T
p.R4366X
p.R4365X
53.01.0E-4Cirnigliaro2023 G
LDLRAD2     mAGRE3018chr1:
22141073-22141073
AACexonicDe novoframeshift insertionNM_001013693c.269dupCp.T90fs--Cirnigliaro2023 G
ALPL     mAGRE4846chr1:
21904139-21904140
TGTexonicPaternalnonframeshift deletionNM_001177520
NM_001127501
NM_000478
c.1343delG
c.1409delG
c.1574delG
p.X448X
p.X470X
p.X525X
-4.0E-4Cirnigliaro2023 G
ALPL     mAGRE2127chr1:
21904139-21904140
TGTexonicMaternalnonframeshift deletionNM_001177520
NM_001127501
NM_000478
c.1343delG
c.1409delG
c.1574delG
p.X448X
p.X470X
p.X525X
-4.0E-4Cirnigliaro2023 G
ALPL     mAGRE1573chr1:
21904139-21904140
TGTexonicPaternalnonframeshift deletionNM_001177520
NM_001127501
NM_000478
c.1343delG
c.1409delG
c.1574delG
p.X448X
p.X470X
p.X525X
-4.0E-4Cirnigliaro2023 G
ALPL     mAGRE6165chr1:
21904124-21904125
CTCexonicPaternalframeshift deletionNM_001177520
NM_001127501
NM_000478
c.1328delT
c.1394delT
c.1559delT
p.L443fs
p.L465fs
p.L520fs
-2.051E-5Cirnigliaro2023 G
ALPL     AU3807302chr1:
21904124-21904125
CTCexonicPaternalframeshift deletionNM_001177520
NM_001127501
NM_000478
c.1328delT
c.1394delT
c.1559delT
p.L443fs
p.L465fs
p.L520fs
-2.051E-5Cirnigliaro2023 G
CNR2     mAGRE5744chr1:
24201717-24201717
GAexonicMaternalstopgainNM_001841c.C391Tp.R131X25.52.0E-4Cirnigliaro2023 G
CNR2     mAGRE1758chr1:
24201027-24201028
AGAexonicMaternalframeshift deletionNM_001841c.1080delCp.C360fs-1.0E-4Cirnigliaro2023 G
FUCA1     mAGRE1321chr1:
24180963-24180963
GAexonicMaternalstopgainNM_000147c.C856Tp.Q286X10.5-Cirnigliaro2023 G
GALE     mAGRE5072chr1:
24124693-24124693
CCAexonicDe novoframeshift insertionNM_001127621
NM_000403
NM_001008216
c.264dupT
c.264dupT
c.264dupT
p.A89fs
p.A89fs
p.A89fs
--Cirnigliaro2023 G
ZBTB40     mAGRE2164chr1:
22779150-22779150
ACsplicingMaternalsplicing--Cirnigliaro2023 G
HSPG2     mAGRE2873chr1:
22207221-22207221
GCexonicMaternalstopgainNM_001291860
NM_005529
c.C1929G
c.C1926G
p.Y643X
p.Y642X
22.1-Cirnigliaro2023 G
HSPG2     mAGRE2872chr1:
22207221-22207221
GCexonicMaternalstopgainNM_001291860
NM_005529
c.C1929G
c.C1926G
p.Y643X
p.Y642X
22.1-Cirnigliaro2023 G
HSPG2     mAGRE3115chr1:
22202171-22202171
CAexonicDe novononsynonymous SNVNM_001291860
NM_005529
c.G3256T
c.G3253T
p.D1086Y
p.D1085Y
11.12-Cirnigliaro2023 G
IL22RA1     mAGRE1391chr1:
24465071-24465071
CTsplicingMaternalsplicing19.678.251E-6Cirnigliaro2023 G
IL22RA1     AU3918302chr1:
24448188-24448189
TGTexonicPaternalframeshift deletionNM_021258c.831delCp.F277fs--Cirnigliaro2023 G
IL22RA1     AU3918301chr1:
24448188-24448189
TGTexonicPaternalframeshift deletionNM_021258c.831delCp.F277fs--Cirnigliaro2023 G
MYOM3     mAGRE2748chr1:
24418785-24418785
CCGexonicMaternalframeshift insertionNM_152372c.1110dupCp.G371fs-2.0E-4Cirnigliaro2023 G
MYOM3     mAGRE2747chr1:
24418785-24418785
CCGexonicMaternalframeshift insertionNM_152372c.1110dupCp.G371fs-2.0E-4Cirnigliaro2023 G
MYOM3     AU2495302chr1:
24411115-24411115
GGAexonicMaternalframeshift insertionNM_152372c.1812dupTp.P605fs-3.36E-5Cirnigliaro2023 G
MYOM3     AU2495301chr1:
24411115-24411115
GGAexonicMaternalframeshift insertionNM_152372c.1812dupTp.P605fs-3.36E-5Cirnigliaro2023 G
MYOM3     AU1894304chr1:
24411115-24411115
GGAexonicPaternalframeshift insertionNM_152372c.1812dupTp.P605fs-3.36E-5Cirnigliaro2023 G
RSRP1     mAGRE4698chr1:
25573047-25573048
TCTexonicPaternalframeshift deletionNM_020317c.407delGp.G136fs-8.255E-6Cirnigliaro2023 G
RSRP1     mAGRE4697chr1:
25573047-25573048
TCTexonicPaternalframeshift deletionNM_020317c.407delGp.G136fs-8.255E-6Cirnigliaro2023 G
SYF2     mAGRE1286chr1:
25554003-25554003
GGTexonicPaternalframeshift insertionNM_207170
NM_015484
c.270dupA
c.396dupA
p.R91fs
p.R133fs
-1.648E-5Cirnigliaro2023 G
SRRM1     mAGRE4881chr1:
24975522-24975522
TCsplicingMaternalsplicing18.385.009E-5Cirnigliaro2023 G
SRRM1     mAGRE4880chr1:
24975522-24975522
TCsplicingMaternalsplicing18.385.009E-5Cirnigliaro2023 G
NIPAL3     mAGRE1787chr1:
24790561-24790566
GAAGAAGexonicMaternalframeshift deletionNM_020448c.973_977delp.K325fs--Cirnigliaro2023 G
STPG1     mAGRE2424chr1:
24687525-24687526
GTGexonicPaternalframeshift deletionNM_178122
NM_001199012
NM_001199013
NM_001199014
c.602delA
c.743delA
c.743delA
c.467delA
p.N201fs
p.N248fs
p.N248fs
p.N156fs
-4.0E-4Cirnigliaro2023 G
STPG1     mAGRE1714chr1:
24687438-24687438
GTexonicMaternalstopgainNM_178122
NM_001199012
NM_001199013
NM_001199014
c.C690A
c.C831A
c.C831A
c.C555A
p.Y230X
p.Y277X
p.Y277X
p.Y185X
21.0-Cirnigliaro2023 G
PAQR7     mAGRE1025chr1:
26190251-26190251
GGAexonicMaternalframeshift insertionNM_178422c.79_80insTp.P27fs--Cirnigliaro2023 G
AUNIP     mAGRE2932chr1:
26161854-26161855
ACAexonicPaternalframeshift deletionNM_001287490
NM_024037
c.703delG
c.703delG
p.V235fs
p.V235fs
-2.0E-4Cirnigliaro2023 G
AUNIP     mAGRE2931chr1:
26161854-26161855
ACAexonicPaternalframeshift deletionNM_001287490
NM_024037
c.703delG
c.703delG
p.V235fs
p.V235fs
-2.0E-4Cirnigliaro2023 G
AUNIP     mAGRE2714chr1:
26161854-26161855
ACAexonicMaternalframeshift deletionNM_001287490
NM_024037
c.703delG
c.703delG
p.V235fs
p.V235fs
-2.0E-4Cirnigliaro2023 G
MTFR1L     mAGRE2195chr1:
26158410-26158410
ATsplicingPaternalsplicing18.938.283E-6Cirnigliaro2023 G
MTFR1L     mAGRE2193chr1:
26158410-26158410
ATsplicingPaternalsplicing18.938.283E-6Cirnigliaro2023 G
SELENON     mAGRE4831chr1:
26128566-26128566
CTexonicMaternalunknown11.68-Cirnigliaro2023 G
LDLRAP1     AU3605304chr1:
25883705-25883705
CTexonicMaternalstopgainNM_015627c.C406Tp.Q136X36.0-Cirnigliaro2023 G
CNKSR1     mAGRE5486chr1:
26508969-26508969
AGsplicingMaternalsplicing11.03-Cirnigliaro2023 G
CNKSR1     mAGRE5485chr1:
26508969-26508969
AGsplicingMaternalsplicing11.03-Cirnigliaro2023 G
CNKSR1     mAGRE5035chr1:
26507093-26507093
CTexonicMaternalstopgainNM_001297647
NM_006314
c.C202T
c.C202T
p.Q68X
p.Q68X
33.01.655E-5Cirnigliaro2023 G
PAFAH2     mAGRE5287chr1:
26317305-26317306
CACexonicPaternalframeshift deletionNM_000437c.2delTp.M1fs-1.0E-4Cirnigliaro2023 G
PAFAH2     mAGRE5286chr1:
26317305-26317306
CACexonicPaternalframeshift deletionNM_000437c.2delTp.M1fs-1.0E-4Cirnigliaro2023 G
PAFAH2     AU3808305chr1:
26317305-26317306
CACexonicPaternalframeshift deletionNM_000437c.2delTp.M1fs-1.0E-4Cirnigliaro2023 G
PAFAH2     AU3808304chr1:
26317305-26317306
CACexonicPaternalframeshift deletionNM_000437c.2delTp.M1fs-1.0E-4Cirnigliaro2023 G
PAFAH2     mAGRE2951chr1:
26299205-26299205
TCsplicingPaternalsplicing20.53.315E-5Cirnigliaro2023 G
PIGV     mAGRE5973chr1:
27124258-27124258
CTexonicMaternalstopgainNM_001202554
NM_017837
c.C1405T
c.C1405T
p.R469X
p.R469X
36.05.766E-5Cirnigliaro2023 G
CRYBG2     mAGRE4572chr1:
26654699-26654699
CGsplicingMaternalsplicing14.0-Cirnigliaro2023 G
UBXN11     mAGRE4703chr1:
26612475-26612475
GAexonicMaternalstopgainNM_001077262
NM_145345
NM_183008
c.C253T
c.C514T
c.C613T
p.Q85X
p.Q172X
p.Q205X
38.02.0E-4Cirnigliaro2023 G
UBXN11     mAGRE4702chr1:
26612475-26612475
GAexonicMaternalstopgainNM_001077262
NM_145345
NM_183008
c.C253T
c.C514T
c.C613T
p.Q85X
p.Q172X
p.Q205X
38.02.0E-4Cirnigliaro2023 G
CEP85     mAGRE2783chr1:
26570810-26570810
GTsplicingMaternalsplicing18.27-Cirnigliaro2023 G
CEP85     mAGRE2782chr1:
26570810-26570810
GTsplicingMaternalsplicing18.27-Cirnigliaro2023 G
CNKSR1     mAGRE4703chr1:
26510738-26510739
GTGexonicPaternalframeshift deletionNM_001297647
NM_001297648
NM_006314
c.982delT
c.187delT
c.961delT
p.S328fs
p.S63fs
p.S321fs
-3.296E-5Cirnigliaro2023 G
CNKSR1     mAGRE4702chr1:
26510738-26510739
GTGexonicPaternalframeshift deletionNM_001297647
NM_001297648
NM_006314
c.982delT
c.187delT
c.961delT
p.S328fs
p.S63fs
p.S321fs
-3.296E-5Cirnigliaro2023 G
MAP3K6     mAGRE2450chr1:
27687695-27687695
CCGexonicMaternalframeshift insertionNM_001297609
NM_004672
c.1760dupC
c.1784dupC
p.P587fs
p.P595fs
-3.002E-5Cirnigliaro2023 G
MAP3K6     mAGRE5546chr1:
27686353-27686353
AATexonicPaternalframeshift insertionNM_001297609
NM_004672
c.2290dupA
c.2314dupA
p.I764fs
p.I772fs
--Cirnigliaro2023 G
MAP3K6     mAGRE5545chr1:
27686353-27686353
AATexonicPaternalframeshift insertionNM_001297609
NM_004672
c.2290dupA
c.2314dupA
p.I764fs
p.I772fs
--Cirnigliaro2023 G
MAP3K6     mAGRE4952chr1:
27683538-27683545
CTGAGCAGCexonicPaternalframeshift deletionNM_001297609
NM_004672
c.3295_3301del
c.3319_3325del
p.L1099fs
p.L1107fs
--Cirnigliaro2023 G
MAP3K6     mAGRE4698chr1:
27683538-27683545
CTGAGCAGCexonicMaternalframeshift deletionNM_001297609
NM_004672
c.3295_3301del
c.3319_3325del
p.L1099fs
p.L1107fs
--Cirnigliaro2023 G
MAP3K6     mAGRE4697chr1:
27683538-27683545
CTGAGCAGCexonicMaternalframeshift deletionNM_001297609
NM_004672
c.3295_3301del
c.3319_3325del
p.L1099fs
p.L1107fs
--Cirnigliaro2023 G
SYTL1     mAGRE2958chr1:
27674329-27674329
CCTGTGexonicMaternalframeshift insertionNM_001193308
NM_032872
c.371_372insTGTG
c.371_372insTGTG
p.A124fs
p.A124fs
-4.99E-5Cirnigliaro2023 G
KDF1     mAGRE3111chr1:
27278781-27278783
CATCexonicMaternalframeshift deletionNM_152365c.89_90delp.Y30fs--Cirnigliaro2023 G
EYA3     mAGRE2045chr1:
28301043-28301044
GAGexonicPaternalframeshift deletionNM_001282561
NM_001282562
NM_001990
c.1517delT
c.1496delT
c.1655delT
p.F506fs
p.F499fs
p.F552fs
--Cirnigliaro2023 G
EYA3     mAGRE2043chr1:
28301043-28301044
GAGexonicPaternalframeshift deletionNM_001282561
NM_001282562
NM_001990
c.1517delT
c.1496delT
c.1655delT
p.F506fs
p.F499fs
p.F552fs
--Cirnigliaro2023 G
SMPDL3B     mAGRE1672chr1:
28285042-28285042
GGCexonicPaternalframeshift insertionNM_001304579
NM_014474
c.444dupC
c.1062dupC
p.R148fs
p.R354fs
--Cirnigliaro2023 G
THEMIS2     mAGRE1829chr1:
28209480-28209480
GGCexonicMaternalframeshift insertionNM_001105556
NM_001286115
NM_001286113
c.1646dupC
c.1058dupC
c.1259dupC
p.A549fs
p.A353fs
p.A420fs
-5.862E-5Cirnigliaro2023 G
FCN3     mAGRE4460chr1:
27699638-27699638
CCTexonicMaternalframeshift insertionNM_173452
NM_003665
c.348_349insA
c.381_382insA
p.G117fs
p.G128fs
-1.666E-5Cirnigliaro2023 G
FCN3     mAGRE4201chr1:
27695876-27695876
CTexonicDe novononsynonymous SNVNM_173452
NM_003665
c.G718A
c.G751A
p.G240S
p.G251S
29.6-Cirnigliaro2023 G
FCN3     mAGRE2496chr1:
27695732-27695732
GAexonicPaternalstopgainNM_173452
NM_003665
c.C862T
c.C895T
p.R288X
p.R299X
14.554.126E-5Cirnigliaro2023 G
FCN3     mAGRE2494chr1:
27695732-27695732
GAexonicPaternalstopgainNM_173452
NM_003665
c.C862T
c.C895T
p.R288X
p.R299X
14.554.126E-5Cirnigliaro2023 G
MECR     mAGRE2678chr1:
29522473-29522473
CTexonicPaternalstopgainNM_001024732
NM_016011
c.G716A
c.G944A
p.W239X
p.W315X
37.0-Cirnigliaro2023 G
MECR