or
or
Exact

Results for "EXOC6"

Variant Events: 15

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EXOC6     5-0087-003chr10:
94659781-94659781
CTintronicDe novo--Yuen2017 G
EXOC6     AU002903chr10:
94802512-94802512
AGintronicDe novo--Yuen2017 G
EXOC6     5-0046-003chr10:
94720649-94720649
GTintronicDe novo--Yuen2017 G
EXOC6     1-0138-003chr10:
94598416-94598416
GTintronicDe novo--Yuen2017 G
EXOC6     1-0751-003chr10:
94754521-94754543
CAATAATAATAATAATAATAATACAATAATAATAATAATAATAintronicDe novo--Yuen2017 G
EXOC6     2-1406-003chr10:
94737529-94737529
AGintronicDe novo--Yuen2017 G
EXOC6     AU0780302chr10:
94625161-94625161
CTintronicDe novo--Yuen2017 G
EXOC6     1-0339-004chr10:
94667458-94667462
CAGATCintronicDe novo--Yuen2017 G
EXOC6     Codina-Sola2015:ASD_28chr10:
94594563-94594563
CCTATTexonicPaternalframeshift insertionNM_001013848c.68_69insTATTp.P23fs--Codina-Sola2015 E
EXOC6     1-0126-003chr10:
94695124-94695124
AGintronicDe novo--Yuen2017 G
EXOC6     2-0296-003chr10:
94641020-94641020
GCintronicDe novo--Yuen2017 G
EXOC6     12363.p1chr10:
94659341-94659341
TCintronicDe novo-8.578E-6Iossifov2012 E
Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
EXOC6     13649.p1chr10:
94715143-94715143
GAintronicDe novo--Turner2016 G
EXOC6     A4chr10:
94690262-94690262
AAAATintronicDe novo--Wu2018 G
EXOC6     1-0206-003chr10:
94700199-94700199
ATintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More