or
or
Exact

Results for "GSN"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
GSN     PN400491chr9:
124072992-124072992
GAexonicUnknownnonsynonymous SNVNM_000177
NM_001127662
NM_001258029
NM_001258030
NM_198252
NM_001127663
NM_001127664
NM_001127665
NM_001127666
NM_001127667
c.G535A
c.G382A
c.G433A
c.G406A
c.G382A
c.G490A
c.G382A
c.G382A
c.G415A
c.G415A
p.V179M
p.V128M
p.V145M
p.V136M
p.V128M
p.V164M
p.V128M
p.V128M
p.V139M
p.V139M
33.00.005Leblond2019 E
GSN     PN400232chr9:
124072992-124072992
GAexonicUnknownnonsynonymous SNVNM_000177
NM_001127662
NM_001258029
NM_001258030
NM_198252
NM_001127663
NM_001127664
NM_001127665
NM_001127666
NM_001127667
c.G535A
c.G382A
c.G433A
c.G406A
c.G382A
c.G490A
c.G382A
c.G382A
c.G415A
c.G415A
p.V179M
p.V128M
p.V145M
p.V136M
p.V128M
p.V164M
p.V128M
p.V128M
p.V139M
p.V139M
33.00.005Leblond2019 E
GSN     1-0201-005chr9:
124048049-124048049
TAintronicDe novo--Yuen2017 G
GSN     PN400231chr9:
124072992-124072992
GAexonicUnknownnonsynonymous SNVNM_000177
NM_001127662
NM_001258029
NM_001258030
NM_198252
NM_001127663
NM_001127664
NM_001127665
NM_001127666
NM_001127667
c.G535A
c.G382A
c.G433A
c.G406A
c.G382A
c.G490A
c.G382A
c.G382A
c.G415A
c.G415A
p.V179M
p.V128M
p.V145M
p.V136M
p.V128M
p.V164M
p.V128M
p.V128M
p.V139M
p.V139M
33.00.005Leblond2019 E
GSN     12906.p1chr9:
124091158-124091158
TCintronicDe novo--Satterstrom2020 E
GSN     AU054303chr9:
124088249-124088249
CGintronicDe novo--Yuen2017 G
GSN     PN400281chr9:
124074704-124074704
CTexonicUnknownnonsynonymous SNVNM_000177
NM_001127662
NM_001258029
NM_001258030
NM_198252
NM_001127663
NM_001127664
NM_001127665
NM_001127666
NM_001127667
c.C754T
c.C601T
c.C652T
c.C625T
c.C601T
c.C709T
c.C601T
c.C601T
c.C634T
c.C634T
p.R252W
p.R201W
p.R218W
p.R209W
p.R201W
p.R237W
p.R201W
p.R201W
p.R212W
p.R212W
24.1-Leblond2019 E
GSN     iHART1768chr9:
124073124-124073124
GAsplicingPaternalsplicing21.06.679E-5Ruzzo2019 G
GSN     Codina-Sola2015:ASD_27chr9:
124079385-124079385
AGexonicPaternalnonsynonymous SNVNM_000177
NM_001127662
NM_001258029
NM_001258030
NM_198252
NM_001127663
NM_001127664
NM_001127665
NM_001127666
NM_001127667
c.A928G
c.A775G
c.A826G
c.A799G
c.A775G
c.A883G
c.A775G
c.A775G
c.A808G
c.A808G
p.M310V
p.M259V
p.M276V
p.M267V
p.M259V
p.M295V
p.M259V
p.M259V
p.M270V
p.M270V
14.04-Codina-Sola2015 E
GSN     PN400267chr9:
124072992-124072992
GAexonicUnknownnonsynonymous SNVNM_000177
NM_001127662
NM_001258029
NM_001258030
NM_198252
NM_001127663
NM_001127664
NM_001127665
NM_001127666
NM_001127667
c.G535A
c.G382A
c.G433A
c.G406A
c.G382A
c.G490A
c.G382A
c.G382A
c.G415A
c.G415A
p.V179M
p.V128M
p.V145M
p.V136M
p.V128M
p.V164M
p.V128M
p.V128M
p.V139M
p.V139M
33.00.005Leblond2019 E
GSN     iHART2239chr9:
124062146-124062174
CCGCACCGCCCCGCGCCCGCGCTGCTTTGCexonicMaternalframeshift deletionNM_000177c.8_35delp.P3fs--Ruzzo2019 G
GSN     PN400363chr9:
124072992-124072992
GAexonicUnknownnonsynonymous SNVNM_000177
NM_001127662
NM_001258029
NM_001258030
NM_198252
NM_001127663
NM_001127664
NM_001127665
NM_001127666
NM_001127667
c.G535A
c.G382A
c.G433A
c.G406A
c.G382A
c.G490A
c.G382A
c.G382A
c.G415A
c.G415A
p.V179M
p.V128M
p.V145M
p.V136M
p.V128M
p.V164M
p.V128M
p.V128M
p.V139M
p.V139M
33.00.005Leblond2019 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More