
Results for "Leblond2019"

Variant Events: 6768

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
VIL1     PN400103chr2:
CTexonicDe novosynonymous SNVNM_007127c.C783Tp.S261S-3.0E-4Leblond2019 E
KIF17     PN400532chr1:
GAexonicDe novononsynonymous SNVNM_001122819
26.91.649E-5Leblond2019 E
ANKMY1     PN400149chr2:
GAexonicDe novosynonymous SNVNM_001282780
-8.304E-6Leblond2019 E
PLCD4     PN400579chr2:
GAexonicDe novononsynonymous SNVNM_032726c.G2189Ap.R730H33.08.281E-6Leblond2019 E
DUSP12     PN400133chr1:
TCexonicDe novononsynonymous SNVNM_007240c.T763Cp.S255P2.7318.238E-6Leblond2019 E
PHTF1     PN400539chr1:
GAexonicDe novononsynonymous SNVNM_006608c.C1819Tp.R607C17.04-Leblond2019 E
C1orf186     PN400149chr1:
GAexonicDe novosynonymous SNVNM_001007544c.C81Tp.T27T-1.649E-5Leblond2019 E
PLA2G4A     PN400102chr1:
CTexonicDe novononsynonymous SNVNM_001311193
19.22-Leblond2019 E
SH3RF1     PN400512chr4:
CTexonicDe novononsynonymous SNVNM_020870c.G2278Ap.E760K17.278.413E-6Leblond2019 E
COL8A1     PN400560chr3:
CTexonicDe novononsynonymous SNVNM_020351
12.86-Leblond2019 E
SLCO6A1     PN400542chr5:
CTexonicDe novononsynonymous SNVNM_001308014
11.364.954E-5Leblond2019 E
GC     PN400137chr4:
TGexonicDe novononsynonymous SNVNM_000583
19.95-Leblond2019 E
TOPBP1     PN400128chr3:
GAexonicDe novosynonymous SNVNM_007027c.C3747Tp.H1249H--Leblond2019 E
KALRN     PN400117chr3:
AGexonicDe novononsynonymous SNVNM_007064
24.0-Leblond2019 E
ACOX2     PN400157chr3:
CAsplicingDe novosplicing9.54-Leblond2019 E
DCAF1     PN400538chr3:
GCexonicDe novononsynonymous SNVNM_001171904
14.18-Leblond2019 E
CEP72     PN400115chr5:
TCexonicDe novosynonymous SNVNM_018140c.T735Cp.C245C12.03-Leblond2019 E
FCHSD1     PN400117chr5:
AGexonicDe novononsynonymous SNVNM_033449c.T1985Cp.M662T0.398-Leblond2019 E
TAAR1     PN400590chr6:
CTexonicDe novononsynonymous SNVNM_138327c.G679Ap.A227T0.01-Leblond2019 E
SEMA5A     PN400590chr5:
GAexonicDe novononsynonymous SNVNM_003966c.C893Tp.P298L33.0-Leblond2019 E
DAP     PN400157chr5:
CTexonicDe novosynonymous SNVNM_004394c.G195Ap.R65R--Leblond2019 E
CCT5     PN400528chr5:
TGexonicDe novononsynonymous SNVNM_001306154
25.1-Leblond2019 E
HDAC3     PN400149chr5:
AGexonicDe novosynonymous SNVNM_003883c.T1242Cp.Y414Y-8.237E-6Leblond2019 E
PCDHB3     PN400543chr5:
CTexonicDe novononsynonymous SNVNM_018937c.C662Tp.P221L5.2395.798E-5Leblond2019 E
STYXL1     PN400149chr7:
GAexonicMosaic Inh., UnknownstopgainNM_016086c.C154Tp.R52X30.01.678E-5Leblond2019 E
Leblond2019 E
STYXL1     PN400150chr7:
GAexonicMosaic Inh., UnknownstopgainNM_016086c.C154Tp.R52X30.01.678E-5Leblond2019 E
Leblond2019 E
ANKIB1     PN400576chr7:
CTexonicDe novosynonymous SNVNM_019004c.C621Tp.P207P-2.489E-5Leblond2019 E
ANKIB1     PN400215chr7:
AGexonicDe novosynonymous SNVNM_019004c.A114Gp.T38T--Leblond2019 E
PHF14     PN400203chr7:
GAexonicDe novononsynonymous SNVNM_014660c.G2027Ap.R676Q17.53.14E-5Leblond2019 E
MED20     PN400565chr6:
CTexonicDe novononsynonymous SNVNM_001305457
8.897.0E-4Leblond2019 E
AMPH     PN400584chr7:
GAexonicDe novosynonymous SNVNM_139316
1.0468.242E-6Leblond2019 E
MRM2     PN400166chr7:
CTexonicDe novononsynonymous SNVNM_013393c.G475Ap.A159T35.0-Leblond2019 E
C11orf87     PN400540chr11:
CTexonicDe novosynonymous SNVNM_207645c.C336Tp.G112G-8.307E-6Leblond2019 E
ZBTB5     PN400195chr9:
GCexonicDe novononsynonymous SNVNM_014872c.C382Gp.P128A16.318.256E-6Leblond2019 E
SPTBN2     PN400515chr11:
GAexonicDe novo, Unknownnonsynonymous SNVNM_006946c.C5803Tp.R1935C19.862.476E-5Leblond2019 E
Leblond2019 E
PDE3B     PN400171chr11:
CAexonicDe novononsynonymous SNVNM_000922c.C3323Ap.A1108E8.122-Leblond2019 E
LETM2     PN400190chr8:
CTexonicDe novononsynonymous SNVNM_144652
7.838-Leblond2019 E
CDCA2     PN400587chr8:
GAexonicDe novononsynonymous SNVNM_152562c.G517Ap.E173K13.15-Leblond2019 E
FBXW5     PN400129chr9:
GAexonicDe novononsynonymous SNVNM_018998c.C752Tp.T251M11.394.567E-5Leblond2019 E
FBXW5     PN400129chr9:
GAexonicDe novononsynonymous SNVNM_018998c.C1232Tp.S411L24.21.839E-5Leblond2019 E
C2CD4B     PN400137chr15:
TCexonicDe novosynonymous SNVNM_001007595c.A978Gp.E326E--Leblond2019 E
UBL3     PN400579chr13:
GAexonicDe novononsynonymous SNVNM_007106c.C284Tp.P95L29.8-Leblond2019 E
ZNF592     PN400241chr15:
TGexonicDe novononsynonymous SNVNM_014630c.T1197Gp.D399E13.758.244E-6Leblond2019 E
C2CD4B     PN400137chr15:
AGexonicDe novosynonymous SNVNM_001007595c.T957Cp.F319F-1.831E-5Leblond2019 E
CCDC60     PN400564chr12:
CTexonicDe novononsynonymous SNVNM_178499c.C727Tp.R243W13.188.285E-6Leblond2019 E
TSKU     PN400195chr11:
GAexonicDe novosynonymous SNVNM_001258210
--Leblond2019 E
ANKS1B     PN400171chr12:
ATexonicDe novononsynonymous SNVNM_152788c.T2307Ap.N769K12.38-Leblond2019 E
LRRC10     PN400515chr12:
CGexonicDe novosynonymous SNVNM_201550c.G768Cp.A256A--Leblond2019 E
NLGN2     PN400584chr17:
CTexonicDe novosynonymous SNVNM_020795c.C1332Tp.G444G-6.0E-4Leblond2019 E
ADAMTS18     PN400230chr16:
GCexonicDe novosynonymous SNVNM_199355c.C2940Gp.P980P--Leblond2019 E
CIDEA     PN400575chr18:
GAexonicDe novononsynonymous SNVNM_001279c.G143Ap.R48H22.55.786E-5Leblond2019 E
B3GNTL1     PN400546chr17:
AGexonicDe novononsynonymous SNVNM_001009905c.T197Cp.I66T16.642.471E-5Leblond2019 E
GPR139     PN400527chr16:
CTexonicDe novosynonymous SNVNM_001002911c.G1059Ap.P353P-6.67E-5Leblond2019 E
ANPEP     PN400171chr15:
CGexonicDe novosynonymous SNVNM_001150c.G1197Cp.V399V--Leblond2019 E
DDX19A       PN400551chr16:
GAexonicDe novononsynonymous SNVNM_018332c.G316Ap.V106I12.96-Leblond2019 E
MMP25     PN400137chr16:
TCexonicDe novononsynonymous SNVNM_022468c.T1607Cp.L536P12.47-Leblond2019 E
MYH14     PN400543chr19:
GAexonicDe novosynonymous SNVNM_024729
-4.675E-5Leblond2019 E
BCKDHA     PN400219chr19:
GAsplicingDe novosplicing18.64-Leblond2019 E
MORC3     PN400128chr21:
CTexonicDe novo, Unknownnonsynonymous SNVNM_015358c.C1258Tp.R420W20.4-Leblond2019 E
Leblond2019 E
RIMS4     PN400137chr20:
GTexonicDe novo, UnknownstopgainNM_001205317
19.6-Leblond2019 E
Leblond2019 E
MEX3D     PN400170chr19:
GAexonicDe novononsynonymous SNVNM_001174118
15.431.0E-4Leblond2019 E
CCBE1     PN400117chr18:
TCexonicDe novononsynonymous SNVNM_133459c.A163Gp.T55A17.84-Leblond2019 E
LRP3     PN400149chr19:
CTexonicDe novononsynonymous SNVNM_002333c.C1244Tp.A415V14.13-Leblond2019 E
BTBD2     PN400118chr19:
TCexonicDe novononsynonymous SNVNM_017797c.A1360Gp.K454E7.431-Leblond2019 E
C1orf50     PN400100chr1:
GAexonicUnknownnonsynonymous SNVNM_024097c.G383Ap.G128D34.0-Leblond2019 E
MACF1     PN400100chr1:
GAexonicUnknownnonsynonymous SNVNM_012090c.G11827Ap.E3943K35.05.0E-4Leblond2019 E
IGSF3     PN400100chr1:
40.0-Leblond2019 E
LRRC41     PN400100chr1:
CAexonicUnknownnonsynonymous SNVNM_006369c.G115Tp.G39C27.42.0E-4Leblond2019 E
FBLN1     PN400582chr22:
CAexonicDe novosynonymous SNVNM_001996
--Leblond2019 E
TRIOBP     PN400157chr22:
CTexonicDe novosynonymous SNVNM_007032
8.469-Leblond2019 E
GRIPAP1     PN400137chrX:
AGexonicDe novononsynonymous SNVNM_020137c.T377Cp.V126A0.008-Leblond2019 E
MECP2     PN400532chrX:
GAexonicDe novo, Unknownnonsynonymous SNVNM_001110792
23.21.143E-5Leblond2019 E
Leblond2019 E
PCDHA12     PN400100chr5:
38.0-Leblond2019 E
NNT     PN400100chr5:
AAGexonicUnknownframeshift insertionNM_012343
-7.265E-5Leblond2019 E
HLA-DRB1     PN400100chr6:
ACAexonicUnknownframeshift deletionNM_002124c.587delGp.S196fs-0.0066Leblond2019 E
FAM8A1     PN400100chr6:
CGCGGCGCCGCCGCCCCCGCAGCTGGGCTATTCexonicUnknownframeshift deletionNM_016255c.484_514delp.A162fs--Leblond2019 E
IGSF3     PN400100chr1:
GAexonicUnknownnonsynonymous SNVNM_001007237
26.28.361E-6Leblond2019 E
IGSF3     PN400100chr1:
35.0-Leblond2019 E
IGSF3     PN400100chr1:
37.08.27E-6Leblond2019 E
IGSF3     PN400100chr1:
CTexonicUnknownnonsynonymous SNVNM_001542
31.0-Leblond2019 E
CTBP2     PN400100chr10:
GAexonicUnknownnonsynonymous SNVNM_022802
24.9-Leblond2019 E
PRSS3     PN400100chr9:
TGATexonicUnknownframeshift deletionNM_001197097c.9_10delp.M3fs-0.0398Leblond2019 E
HMBS     PN400100chr11:
CTexonicUnknownnonsynonymous SNVNM_000190
33.01.647E-5Leblond2019 E
CTBP2     PN400100chr10:
CGCexonicUnknownframeshift deletionNM_022802
--Leblond2019 E
HLA-DRB1     PN400100chr6:
CCTexonicUnknownframeshift insertionNM_002124c.401dupAp.K134fs-0.0561Leblond2019 E
HLA-DRB1     PN400100chr6:
TGTexonicUnknownframeshift deletionNM_002124c.406delCp.Q136fs-0.0555Leblond2019 E
WDR60     PN400100chr7:
AATexonicUnknownframeshift insertionNM_018051c.1256dupTp.I419fs--Leblond2019 E
MUC12     PN400100chr7:
CTintronicUnknown9.446-Leblond2019 E
PABPC3     PN400100chr13:
CTexonicUnknownstopgainNM_030979c.C874Tp.Q292X35.05.0E-4Leblond2019 E
PABPC3     PN400100chr13:
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
TYRO3     PN400100chr15:
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
PABPC3     PN400100chr13:
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
GXYLT1     PN400100chr12:
CAexonicUnknownnonsynonymous SNVNM_001099650
28.9-Leblond2019 E
GXYLT1     PN400100chr12:
33.0-Leblond2019 E
GXYLT1     PN400100 Complex Event; expand row to view variants  Unknownframeshift insertion, nonframeshift deletionNM_001099650
--Leblond2019 E
Leblond2019 E
GXYLT1     PN400100chr12:
CTexonicUnknownnonsynonymous SNVNM_001099650
36.0-Leblond2019 E
UNC13A     PN400100chr19:
CTexonicUnknownnonsynonymous SNVNM_001080421c.G3982Ap.G1328S23.9-Leblond2019 E
ABCA7     PN400100chr19:
AGGAGCAGAexonicUnknownframeshift deletionNM_019112c.2124_2130delp.E708fs-0.0024Leblond2019 E
NIT1     PN400102chr1:
TAGTexonicUnknownframeshift deletionNM_001185093
--Leblond2019 E
MEGF8     PN400100chr19:
CTexonicUnknownnonsynonymous SNVNM_001410
18.568.0E-4Leblond2019 E
HYDIN     PN400100chr16:
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
MEGF11     PN400100chr15:
CTexonicUnknownnonsynonymous SNVNM_032445c.G2695Ap.D899N25.50.001Leblond2019 E
LAMA1     PN400100chr18:
CTexonicUnknownnonsynonymous SNVNM_005559c.G674Ap.R225H33.00.0064Leblond2019 E
GAS8     PN400100chr16:
GAexonicUnknownnonsynonymous SNVNM_001286209
29.50.0032Leblond2019 E
MUC12     PN400102chr7:
GAintronicUnknown11.98-Leblond2019 E
GRIK2     PN400102chr6:
TGexonicUnknownstopgainNM_001166247c.T2663Gp.L888X43.0-Leblond2019 E
CTBP2     PN400102chr10:
GAexonicUnknownnonsynonymous SNVNM_022802
24.9-Leblond2019 E
LZTS2     PN400102chr10:
CTexonicUnknownnonsynonymous SNVNM_032429c.C1153Tp.R385W25.01.0E-4Leblond2019 E
CACNA2D3     PN400102chr3:
CTexonicUnknownnonsynonymous SNVNM_018398c.C2195Tp.T732M25.80.0076Leblond2019 E
GORASP1     PN400102chr3:
CAexonicUnknownnonsynonymous SNVNM_001278790
19.940.0086Leblond2019 E
ALDH5A1     PN400102chr6:
CTexonicUnknownnonsynonymous SNVNM_001080
19.932.0E-4Leblond2019 E
BCL6     PN400102chr3:
GAexonicUnknownnonsynonymous SNVNM_001134738
21.11.0E-4Leblond2019 E
GXYLT1     PN400102 Complex Event; expand row to view variants  Unknownframeshift insertion, nonframeshift deletionNM_001099650
--Leblond2019 E
Leblond2019 E
GXYLT1     PN400102chr12:
CTexonicUnknownnonsynonymous SNVNM_001099650
36.0-Leblond2019 E
PABPC3     PN400102chr13:
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
PABPC3     PN400102chr13:
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
ARHGEF17     PN400102chr11:
GAexonicUnknownnonsynonymous SNVNM_014786c.G5744Ap.R1915Q35.00.0017Leblond2019 E
CTBP2     PN400102chr10:
CGCexonicUnknownframeshift deletionNM_022802
--Leblond2019 E
GXYLT1     PN400102chr12:
CAexonicUnknownnonsynonymous SNVNM_001099650
28.9-Leblond2019 E
GXYLT1     PN400102chr12:
33.0-Leblond2019 E
CNN2     PN400102chr19:
CAexonicUnknownnonsynonymous SNVNM_201277
22.68.565E-5Leblond2019 E
CNN2     PN400102chr19:
GAexonicUnknownnonsynonymous SNVNM_201277
28.73.0E-4Leblond2019 E
TTC3     PN400102chr21:
GAintronicUnknown14.170.0081Leblond2019 E
CAPN12     PN400102chr19:
GAexonicUnknownnonsynonymous SNVNM_144691c.C685Tp.R229C18.410.0012Leblond2019 E
ABCA3     PN400102chr16:
TAexonicUnknownnonsynonymous SNVNM_001089c.A875Tp.E292V25.00.0022Leblond2019 E
HERC2     PN400102chr15:
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
HYDIN     PN400102chr16:
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
HYDIN     PN400102chr16:
GAexonicUnknownnonsynonymous SNVNM_001270974c.C11242Tp.R3748C18.08.328E-6Leblond2019 E
RPL14     PN400103chr3:
GGCCCTTCCCGGACTCGCGintronicUnknown-0.0032Leblond2019 E
PAQR6     PN400103chr1:
CCACexonicUnknownframeshift deletionNM_001272104
-5.031E-5Leblond2019 E
MUC12     PN400103chr7:
CTintronicUnknown9.446-Leblond2019 E
SDHA     PN400103chr5:
CTTCexonicUnknownframeshift deletionNM_001294332
-0.0135Leblond2019 E
IGSF3     PN400103chr1:
GAexonicUnknownnonsynonymous SNVNM_001007237
26.28.361E-6Leblond2019 E
IGSF3     PN400103chr1:
35.0-Leblond2019 E
IGSF3     PN400103chr1:
37.08.27E-6Leblond2019 E
IGSF3     PN400103chr1:
CTexonicUnknownnonsynonymous SNVNM_001542
31.0-Leblond2019 E
GXYLT1     PN400103chr12:
33.0-Leblond2019 E
DTX4     PN400103chr11:
CTexonicUnknownnonsynonymous SNVNM_015177c.C308Tp.T103M24.95.793E-5Leblond2019 E
GXYLT1     PN400103chr12:
CTexonicUnknownnonsynonymous SNVNM_001099650
36.0-Leblond2019 E
GXYLT1     PN400103chr12:
CAexonicUnknownnonsynonymous SNVNM_001099650
28.9-Leblond2019 E
LZTS2     PN400103chr10:
CTexonicUnknownnonsynonymous SNVNM_032429c.C1153Tp.R385W25.01.0E-4Leblond2019 E
MUC12     PN400103chr7:
GAintronicUnknown11.98-Leblond2019 E
CTBP2     PN400103chr10:
CGCexonicUnknownframeshift deletionNM_022802
--Leblond2019 E
CTBP2     PN400103chr10:
GAexonicUnknownnonsynonymous SNVNM_022802
24.9-Leblond2019 E
HERC2     PN400103chr15:
TCTexonicUnknownframeshift deletionNM_004667c.836delGp.G279fs-0.1711Leblond2019 E
PABPC3     PN400103chr13:
CTexonicUnknownnonsynonymous SNVNM_030979c.C1120Tp.R374C14.86-Leblond2019 E
DMXL2     PN400103chr15:
CTGCexonicUnknownframeshift deletionNM_001174117
-4.507E-5Leblond2019 E
TYRO3     PN400103chr15:
GGGAGAexonicUnknownframeshift insertionNM_006293c.1579_1580insGAGAp.G527fs-0.001Leblond2019 E
PABPC3     PN400103chr13:
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
GOLGA3     PN400103chr12:
GAexonicUnknownnonsynonymous SNVNM_001172557
23.20.0062Leblond2019 E
PABPC3     PN400103chr13:
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
PABPC3     PN400103chr13:
CTexonicUnknownstopgainNM_030979c.C874Tp.Q292X35.05.0E-4Leblond2019 E
IGSF3     PN400104chr1:
GAexonicUnknownnonsynonymous SNVNM_001007237
26.28.361E-6Leblond2019 E
IGSF3     PN400104chr1:
35.0-Leblond2019 E
IGSF3     PN400104chr1:
37.08.27E-6Leblond2019 E
IGSF3     PN400104chr1:
CTexonicUnknownnonsynonymous SNVNM_001542
31.0-Leblond2019 E
PSMC5     PN400103chr17:
37.0-Leblond2019 E
HYDIN     PN400103chr16:
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
LRRC41     PN400104chr1:
CAexonicUnknownnonsynonymous SNVNM_006369c.G115Tp.G39C27.42.0E-4Leblond2019 E
CNN2     PN400103chr19:
GAexonicUnknownnonsynonymous SNVNM_201277
28.73.0E-4Leblond2019 E
OPRM1     PN400104chr6:
GAexonicUnknownnonsynonymous SNVNM_001285527
33.06.625E-5Leblond2019 E
SYNE1     PN400104chr6:
GAexonicUnknownnonsynonymous SNVNM_033071
34.00.0018Leblond2019 E
MUC3A     PN400104 Complex Event; expand row to view variants  Unknownframeshift deletionNM_005960
-3.541E-5Leblond2019 E
Leblond2019 E
TRRAP     PN400104chr7:
CTexonicUnknownnonsynonymous SNVNM_003496
33.01.0E-4Leblond2019 E
SCN9A     PN400104chr2:
CTexonicUnknownnonsynonymous SNVNM_002977c.G554Ap.R185H27.10.0033Leblond2019 E
NOTCH2NL     PN400104chr1:
CTexonicUnknownstopgainNM_203458c.C220Tp.R74X23.10.0873Leblond2019 E
AKAP12     PN400104chr6:
CTexonicUnknownnonsynonymous SNVNM_144497
28.41.65E-5Leblond2019 E
IKZF2     PN400104chr2:
CAACintronicUnknown-0.2884Leblond2019 E
CTBP2     PN400104chr10:
CGCexonicUnknownframeshift deletionNM_022802
--Leblond2019 E
CTBP2     PN400104chr10:
GAexonicUnknownnonsynonymous SNVNM_022802
24.9-Leblond2019 E
GXYLT1     PN400104chr12:
33.0-Leblond2019 E
CTBP2     PN400104chr10:
38.0-Leblond2019 E
MUC12     PN400104chr7:
GAintronicUnknown11.98-Leblond2019 E
MUC12     PN400104chr7:
CTintronicUnknown9.446-Leblond2019 E
PRSS3     PN400104chr9:
TGATexonicUnknownframeshift deletionNM_001197097c.9_10delp.M3fs-0.0398Leblond2019 E
ST18     PN400104chr8:
GTexonicUnknownnonsynonymous SNVNM_014682c.C2834Ap.A945E29.00.0036Leblond2019 E
PABPC3     PN400104chr13:
CTexonicUnknownstopgainNM_030979c.C874Tp.Q292X35.05.0E-4Leblond2019 E
PABPC3     PN400104chr13:
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
PABPC3     PN400104chr13:
CTexonicUnknownnonsynonymous SNVNM_030979c.C1120Tp.R374C14.86-Leblond2019 E
PABPC3     PN400104chr13:
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
GXYLT1     PN400104chr12:
CTexonicUnknownnonsynonymous SNVNM_001099650
36.0-Leblond2019 E
GXYLT1     PN400104chr12:
CAexonicUnknownnonsynonymous SNVNM_001099650
28.9-Leblond2019 E
KRT1     PN400104chr12:
GAexonicUnknownnonsynonymous SNVNM_006121c.C1294Tp.R432C21.06.0E-4Leblond2019 E
GXYLT1     PN400104 Complex Event; expand row to view variants  Unknownframeshift insertion, nonframeshift deletionNM_001099650
--Leblond2019 E
Leblond2019 E
IGSF3     PN400108chr1:
35.0-Leblond2019 E
GTPBP1     PN400104chr22:
CAexonicUnknownnonsynonymous SNVNM_004286c.C1558Ap.Q520K34.00.0045Leblond2019 E
IGSF3     PN400108chr1:
CTexonicUnknownnonsynonymous SNVNM_001542
31.0-Leblond2019 E
IGSF3     PN400108chr1:
GAexonicUnknownnonsynonymous SNVNM_001007237
26.28.361E-6Leblond2019 E
HYDIN     PN400104chr16:
AATexonicUnknownframeshift insertionNM_001270974c.6574_6575insAp.L2192fs--Leblond2019 E
HYDIN     PN400104chr16:
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
LONP1     PN400104chr19:
CTexonicUnknownnonsynonymous SNVNM_001276480
26.62.0E-4Leblond2019 E
HYDIN     PN400104chr16:
CCGAATAATAATAexonicUnknownframeshift insertionNM_001270974c.6572_6573insTATTATTATTCp.W2191fs--Leblond2019 E
MUC12     PN400108chr7:
GAintronicUnknown11.98-Leblond2019 E
VPS41     PN400108chr7:
GAexonicUnknownnonsynonymous SNVNM_080631
17.080.0026Leblond2019 E
KMT2C     PN400108chr7:
CTexonicUnknownnonsynonymous SNVNM_170606c.G943Ap.G315S22.30.0832Leblond2019 E
KMT2C     PN400108chr7:
GTexonicUnknownstopgainNM_170606c.C1173Ap.C391X39.00.0294Leblond2019 E
IKZF2     PN400108chr2:
CAACintronicUnknown-0.2884Leblond2019 E
IGSF3     PN400108chr1:
37.08.27E-6Leblond2019 E
ZNF608     PN400108chr5:
GAexonicUnknownnonsynonymous SNVNM_020747c.C3976Tp.R1326W19.091.647E-5Leblond2019 E
PRKCI     PN400108chr3:
GAexonicUnknownnonsynonymous SNVNM_002740c.G1378Ap.D460N34.0-Leblond2019 E
CTBP2     PN400108chr10:
CGCexonicUnknownframeshift deletionNM_022802
--Leblond2019 E
CTBP2     PN400108chr10:
CAexonicUnknownnonsynonymous SNVNM_022802
32.0-Leblond2019 E
GXYLT1     PN400108chr12:
CAexonicUnknownnonsynonymous SNVNM_001099650
28.9-Leblond2019 E
GXYLT1     PN400108chr12:
33.0-Leblond2019 E
CYHR1     PN400108chr8:
GGCexonicUnknownframeshift insertionNM_001129888
-0.0044Leblond2019 E
TTI2     PN400108chr8:
GAexonicUnknownnonsynonymous SNVNM_025115
18.671.0E-4Leblond2019 E
CTBP2     PN400108chr10:
CTexonicUnknownnonsynonymous SNVNM_022802
35.0-Leblond2019 E
PRSS3     PN400108chr9:
TGATexonicUnknownframeshift deletionNM_001197097c.9_10delp.M3fs-0.0398Leblond2019 E
PABPC3     PN400108chr13:
AGAexonicUnknownframeshift deletionNM_030979c.937delGp.A313fs--Leblond2019 E
PABPC3     PN400108chr13:
CTexonicUnknownstopgainNM_030979c.C874Tp.Q292X35.05.0E-4Leblond2019 E
MRPL28     PN400108chr16:
BRCA2     PN400108chr13:
ATexonicUnknownstopgainNM_000059c.A9976Tp.K3326X51.00.007Leblond2019 E
GXYLT1     PN400108 Complex Event; expand row to view variants  Unknownframeshift insertion, nonframeshift deletionNM_001099650
--Leblond2019 E
Leblond2019 E
GXYLT1     PN400108chr12:
CTexonicUnknownnonsynonymous SNVNM_001099650
36.0-Leblond2019 E
PABPC3     PN400108chr13:
AATexonicUnknownframeshift insertionNM_030979c.761_762insTp.K254fs-0.1057Leblond2019 E
PAH     PN400108chr12:
GAexonicUnknownnonsynonymous SNVNM_000277c.C1222Tp.R408W19.027.0E-4Leblond2019 E
IGSF3     PN400111chr1:
GAexonicUnknownnonsynonymous SNVNM_001007237
26.28.361E-6Leblond2019 E
IGSF3     PN400111chr1:
35.0-Leblond2019 E
IGSF3     PN400111chr1:
37.08.27E-6Leblond2019 E
IGSF3     PN400111chr1:
CTexonicUnknownnonsynonymous SNVNM_001542
31.0-Leblond2019 E
HYDIN     PN400108chr16:
AATGTGGGGTexonicUnknownframeshift insertionNM_001270974c.6584_6585insACCCCACAp.S2195fs--Leblond2019 E
HYDIN     PN400108chr16:
GAexonicUnknownnonsynonymous SNVNM_001270974c.C11242Tp.R3748C18.08.328E-6Leblond2019 E
PANK4     PN400111chr1:
CGCintronicUnknown--Leblond2019 E
DCAF15     PN400108chr19:
AAGGTGGGCCCAGGGCGGGCAGexonicUnknownframeshift insertionNM_138353c.1439_1440insGGTGGGCCCAGGGCGGGCAGp.E480fs-0.2634Leblond2019 E
HLA-DRB1     PN400111chr6:
TGTexonicUnknownframeshift deletionNM_002124c.406delCp.Q136fs-0.0555Leblond2019 E
HLA-DRB1     PN400111chr6:
ACAexonicUnknownframeshift deletionNM_002124c.587delGp.S196fs-0.0066Leblond2019 E
MUC12     PN400111chr7:
CTintronicUnknown9.446-Leblond2019 E
HLA-DRB1     PN400111chr6:
CCTexonicUnknownframeshift insertionNM_002124c.401dupAp.K134fs-0.0561Leblond2019 E
TRAK1     PN400111chr3:
GAexonicUnknownnonsynonymous SNVNM_001265609
28.30.0023Leblond2019 E
SCN9A     PN400111chr2:
CTexonicUnknownnonsynonymous SNVNM_002977c.G554Ap.R185H27.10.0033Leblond2019 E
FAM8A1     PN400111chr6:
CGCGGCGCCGCCGCCCCCGCAGCTGGGCTATTCexonicUnknownframeshift deletionNM_016255c.484_514delp.A162fs--Leblond2019 E
FSTL4     PN400111chr5: