or
or
Exact

Results for "PIEZO1"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PIEZO1     SSC06937chr16:
88786181-88786181
GTintronicDe novo--Trost2022 G
PIEZO1     7-0320-003chr16:
88787865-88787865
GAintronicDe novo--Trost2022 G
PIEZO1     CC1262_201chr16:
88792793-88792793
GAexonicDe novosynonymous SNVNM_001142864c.C3867Tp.S1289S6.152-Fu2022 E
PIEZO1     SP0014626chr16:
88783156-88783156
CAintronicDe novo--Trost2022 G
PIEZO1     SP0138673chr16:
88788618-88788618
GAintronicDe novo-3.0E-4Trost2022 G
Zhou2022 GE
PIEZO1     SP0149915chr16:
88783627-88783627
GAintronicDe novo--Fu2022 E
Trost2022 G
Zhou2022 GE
PIEZO1     SP0024792chr16:
88788378-88788378
GAexonicDe novosynonymous SNVNM_001142864c.C5052Tp.A1684A9.3345.0E-4Trost2022 G
Zhou2022 GE
PIEZO1     14011.p1chr16:
88787105-88787105
GCexonicDe novononsynonymous SNVNM_001142864c.C5720Gp.T1907R6.887-Krumm2015 E
PIEZO1     006-07-107598chr16:
88801323-88801323
AGexonicDe novononsynonymous SNVNM_001142864c.T1808Cp.V603A20.8-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
PIEZO1     13071.p1chr16:
88792870-88792870
GAintronicDe novo-5.105E-5Krumm2015 E
Zhou2022 GE
PIEZO1     13309.p1chr16:
88786181-88786181
GTintronicDe novo--Satterstrom2020 E
PIEZO1     MSSNG00364-003chr16:
88839522-88839531
ACCAGCGGCTAintronicDe novo--Trost2022 G
PIEZO1     1-1000-003Achr16:
88844727-88844727
GAintronicDe novo--Trost2022 G
PIEZO1     3-0713-000chr16:
88826482-88826482
CTintronicDe novo--Trost2022 G
PIEZO1     2-1166-003chr16:
88855030-88855030
CTintergenicDe novo--Yuen2017 G
PIEZO1     Kim2020:B3chr16:
88805034-88805059
GGCCGTGACTCGGAAACGAGCGGCCAGexonicDe novoframeshift deletionNM_001142864c.551_575delp.L184fs--Kim2020 E
PIEZO1     AU4072303chr16:
88801310-88801310
GAexonicDe novosynonymous SNVNM_001142864c.C1821Tp.L607L11.2-Trost2022 G
Yuen2017 G
Zhou2022 GE
PIEZO1     SP0043623chr16:
88788455-88788455
GTexonicDe novononsynonymous SNVNM_001142864c.C4975Ap.L1659M21.4-Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
PIEZO1     11089.p1chr16:
88816426-88816426
GAintronicDe novo--Turner2016 G
PIEZO1     1409001chr16:
88800398-88800398
GCexonicDe novononsynonymous SNVNM_001142864c.C2245Gp.Q749E0.0052.0E-4Satterstrom2020 E
Trost2022 G
Zhou2022 GE
PIEZO1     SP0047725chr16:
88793502-88793502
GCexonicDe novononsynonymous SNVNM_001142864c.C3400Gp.R1134G2.483-Fu2022 E
Zhou2022 GE
PIEZO1     1-1000-003chr16:
88844727-88844727
GAintronicDe novo--Yuen2017 G
PIEZO1     SP0060755chr16:
88804194-88804194
GAexonicDe novononsynonymous SNVNM_001142864c.C1049Tp.A350V12.355.575E-5Fu2022 E
Zhou2022 GE
PIEZO1     SP0032493chr16:
88802608-88802608
CTexonicDe novononsynonymous SNVNM_001142864c.G1505Ap.R502H11.68-Fu2022 E
Zhou2022 GE
PIEZO1     SP0130488chr16:
88788171-88788171
CTintronicDe novo-8.967E-5Fu2022 E
Trost2022 G
PIEZO1     SP0142938chr16:
88786466-88786466
CTintronicDe novo--Fu2022 E
Trost2022 G
PIEZO1     SP0001493chr16:
88802612-88802612
GAexonicDe novosynonymous SNVNM_001142864c.C1501Tp.L501L10.19-Fu2022 E
Trost2022 G
Zhou2022 GE
PIEZO1     DEASD_1096_001chr16:
88798890-88798890
GAexonicDe novosynonymous SNVNM_001142864c.C2844Tp.R948R8.69-Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
PIEZO1     SP0004698chr16:
88787967-88787967
GAexonicDe novosynonymous SNVNM_001142864c.C5382Tp.F1794F10.42-Fu2022 E
Trost2022 G
Zhou2022 GE
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More