
Results for "ASXL3"

Variant Events: 131

Gene symbol on which the variant is located
Subject Identifier from the original study
Genomic location of the reference allele
Reference allele
Alternate allele
Variant functional categories
Variant validation performed by an orthogonal method and reported
Reported inheritance status
Variant effect on transcript per Annovar
Transcript used for the cDNA/Protein mutation
cDNA variant notation
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Source(s) where variants from this event are reported
ASXL3     M16220chr18:
TGexonicMaternalnonsynonymous SNVNM_030632c.T2104Gp.S702A11.92-Guo2018 T
ASXL3     AU050603chr18:
GCintronicDe novo--Trost2022 G
Yuen2017 G
ASXL3     M13465chr18:
GAexonicMaternalnonsynonymous SNVNM_030632c.G1741Ap.G581S7.743-Guo2018 T
ASXL3     GX0149.p1chr18:
CTGCexonicDe novoframeshift deletionNM_030632c.4170_4171delp.T1390fs--Guo2018 T
ASXL3     M27809chr18:
AGexonicMaternalnonsynonymous SNVNM_030632c.A2774Gp.H925R16.03-Guo2018 T
ASXL3     M19658chr18:
TAexonicMaternalnonsynonymous SNVNM_030632c.T2113Ap.S705T17.71-Guo2018 T
ASXL3     Chen2021:3chr18:
ACAAexonicDe novoframeshift deletionNM_030632c.1897_1898delp.Q633fs--Chen2021 GET
ASXL3     AU1987304chr18:
TGintronicDe novo--Trost2022 G
Yuen2017 G
ASXL3     1-0054-003chr18:
AACCCCCCCintronicDe novo--Yuen2017 G
ASXL3     M21577chr18:
TCexonicMaternalnonsynonymous SNVNM_030632c.T3976Cp.S1326P1.1837.459E-5Guo2018 T
ASXL3     M08674chr18:
GCexonicMaternalnonsynonymous SNVNM_030632c.G3276Cp.E1092D16.76-Guo2018 T
ASXL3     M08098chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C5081Tp.P1694L0.7664.144E-5Guo2018 T
ASXL3     M11403chr18:
GAexonicMaternalnonsynonymous SNVNM_030632c.G4283Ap.S1428N5.9918.29E-6Guo2018 T
ASXL3     GX0083.p1chr18:
CTexonicDe novostopgainNM_030632c.C5467Tp.R1823X44.0-Guo2018 T
ASXL3     M08602chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C2965Tp.R989W14.42-Guo2018 T
ASXL3     GX0384.p1chr18:
ACAexonicDe novoframeshift deletionNM_030632c.2095delCp.P699fs--Guo2018 T
ASXL3     M18396chr18:
GAexonicMaternalnonsynonymous SNVNM_030632c.G2848Ap.D950N13.4-Guo2018 T
ASXL3     M08446chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C3239Tp.A1080V17.15-Guo2018 T
ASXL3     M01793chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C2978Tp.S993F7.646-Guo2018 T
ASXL3     11782.p1chr18:
GCintronicDe novo--Wilfert2021 G
ASXL3     Li2017:22913chr18:
AGexonicUnknownnonsynonymous SNVNM_030632c.A169Gp.M57V21.1-Li2017 T
ASXL3     M10090chr18:
ACexonicMaternalnonsynonymous SNVNM_030632c.A6473Cp.H2158P17.396.625E-5Guo2018 T
ASXL3     Husson2020:85chr18:
CAexonicstopgainNM_030632c.C3737Ap.S1246X40.0-Husson2020 E
ASXL3     7-0024-005chr18:
ATintronicDe novo--Trost2022 G
Yuen2017 G
ASXL3     ACGC_GX0149.p1chr18:
CTGCexonicDe novoframeshift deletionNM_030632c.4170_4171delp.T1390fs--Wang2020 T
ASXL3     iHART1921chr18:
TTAexonicPaternalframeshift insertionNM_030632c.699dupAp.L233fs--Ruzzo2019 G
ASXL3     ACGC_GX0384.p1chr18:
ACAexonicDe novoframeshift deletionNM_030632c.2095delCp.P699fs--Wang2020 T
ASXL3     ACGC_GX0083.p1chr18:
CTexonicDe novostopgainNM_030632c.C5467Tp.R1823X44.0-Wang2020 T
ASXL3     M32098chr18:
AGexonicPaternalnonsynonymous SNVNM_030632c.A4306Gp.S1436G11.44-Guo2018 T
ASXL3     3-0648-000chr18:
AATTTAintronicDe novo--Trost2022 G
ASXL3     GX0410.p1chr18:
AGexonicPaternalnonsynonymous SNVNM_030632c.A4210Gp.T1404A9.259-Guo2018 T
ASXL3     MT_166.3chr18:
TCintronicDe novo--Trost2022 G
ASXL3     M30363chr18:
CTexonicPaternalnonsynonymous SNVNM_030632c.C5080Tp.P1694S2.729-Guo2018 T
ASXL3     M30366chr18:
GAexonicPaternalnonsynonymous SNVNM_030632c.G4531Ap.V1511I0.0032.0E-4Guo2018 T
ASXL3     REACH000626chr18:
AGintronicDe novo--Trost2022 G
ASXL3     GX0074.p1chr18:
TCexonicPaternalnonsynonymous SNVNM_030632c.T259Cp.S87P15.73-Guo2018 T
ASXL3     M30928chr18:
AGexonicPaternalnonsynonymous SNVNM_030632c.A2761Gp.R921G14.0-Guo2018 T
ASXL3     GX0103.p1chr18:
CGexonicPaternalnonsynonymous SNVNM_030632c.C2168Gp.P723R14.88.283E-6Guo2018 T
ASXL3     MSSNG00060-003chr18:
CTdownstreamDe novo--Trost2022 G
ASXL3     GX0197.p1chr18:
CGexonicPaternalnonsynonymous SNVNM_030632c.C5449Gp.P1817A12.67-Guo2018 T
ASXL3     1-1109-003chr18:
GAintronicDe novo--Trost2022 G
ASXL3     GX0007.p1chr18:
CTexonicPaternalnonsynonymous SNVNM_030632c.C5252Tp.T1751M19.891.659E-5Guo2018 T
ASXL3     5-5046-004chr18:
CTintronicDe novo--Trost2022 G
ASXL3     1-0271-003chr18:
TGintronicDe novo--Trost2022 G
ASXL3     AU3680302chr18:
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASXL3     GX0466.p1chr18:
ACexonicPaternalnonsynonymous SNVNM_030632c.A6473Cp.H2158P17.396.625E-5Guo2018 T
ASXL3     7-0309-004chr18:
ATintronicDe novo--Trost2022 G
ASXL3     HEN0003.p1chr18:
GCexonicPaternalnonsynonymous SNVNM_030632c.G5992Cp.E1998Q13.338.317E-5Guo2018 T
ASXL3     GX0539.p1chr18:
CGexonicPaternalnonsynonymous SNVNM_030632c.C5065Gp.P1689A2.808-Guo2018 T
ASXL3     SD0088.p1chr18:
CTexonicPaternalnonsynonymous SNVNM_030632c.C257Tp.S86L24.3-Guo2018 T
ASXL3     DEASD_0395_001chr18:
CTexonicDe novo, UnknownstopgainNM_030632c.C3106Tp.R1036X38.0-DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
ASXL3     M03353chr18:
CTexonicUnknownnonsynonymous SNVNM_030632c.C2978Tp.S993F7.646-Guo2018 T
ASXL3     HEN0037.p1chr18:
AGexonicPaternalnonsynonymous SNVNM_030632c.A4904Gp.E1635G5.121-Guo2018 T
ASXL3     NDAR_INVLR026ZEP_wes1chr18:
CCTexonicDe novo, Unknownframeshift insertionNM_030632c.4170dupTp.T1390fs--DeRubeis2014 E
Fu2022 E
Kosmicki2017 E
Satterstrom2020 E
Trost2022 G
Wang2020 T
Zhou2022 GE
ASXL3     HEN0162.p1chr18:
GAexonicPaternalnonsynonymous SNVNM_030632c.G3383Ap.R1128Q15.59-Guo2018 T
ASXL3     TASC_217-14320-4340chr18:
CTexonicUnknownnonsynonymous SNVNM_030632c.C3526Tp.R1176W20.24.157E-5Wang2020 T
ASXL3     ACGC_HN0116.p1chr18:
CTexonicUnknownnonsynonymous SNVNM_030632c.C541Tp.R181C17.96-Wang2020 T
ASXL3     Miyake2023:2239chr18:
GGGexonicDe novoframeshift deletionNM_030632c.1088delGp.G363fs--Miyake2023 E
ASXL3     SP0111210chr18:
AGCAexonicDe novoframeshift deletionNM_030632c.4180_4181delp.A1394fs--Fu2022 E
Trost2022 G
Zhou2022 GE
ASXL3     SP0037585chr18:
CAintronicDe novo--Fu2022 E
ASXL3     AU1244301chr18:
GAsplicingInheritedsplicing15.16-Stessman2017 T
ASXL3     AU049304chr18:
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASXL3     SP0010005chr18:
CGexonicDe novostopgainNM_030632c.C4322Gp.S1441X42.0-Fu2022 E
Trost2022 G
Zhou2022 GE
ASXL3     SP0111212chr18:
AGCAexonicDe novoframeshift deletionNM_030632c.4180_4181delp.A1394fs--Fu2022 E
Trost2022 G
Zhou2022 GE
ASXL3     mAGRE4743chr18:
GAsplicingDe novosplicing15.16-Cirnigliaro2023 G
ASXL3     SP0068299chr18:
TCintronicDe novo--Fu2022 E
ASXL3     mAGRE1921chr18:
TTAexonicPaternalframeshift insertionNM_030632c.699dupAp.L233fs--Cirnigliaro2023 G
ASXL3     SP0141034chr18:
TCexonicDe novosynonymous SNVNM_030632c.T3777Cp.D1259D--Fu2022 E
Trost2022 G
Zhou2022 GE
ASXL3     GX0235.p1chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C3239Tp.A1080V17.15-Guo2018 T
ASXL3     GX0024.p1chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C3178Tp.R1060W17.88.402E-6Guo2018 T
ASXL3     HN0102.p1chr18:
TCexonicMaternalnonsynonymous SNVNM_030632c.T3976Cp.S1326P1.1837.459E-5Guo2018 T
ASXL3     HN0122.p1chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C3737Tp.S1246L16.758.293E-6Guo2018 T
ASXL3     GX0516.p1chr18:
CGexonicMaternalnonsynonymous SNVNM_030632c.C2939Gp.A980G22.6-Guo2018 T
ASXL3     GX0187.p1chr18:
CGexonicMaternalnonsynonymous SNVNM_030632c.C2168Gp.P723R14.88.283E-6Guo2018 T
ASXL3     AU4372309chr18:
AGintergenicDe novo--Yuen2017 G
ASXL3     GX0157.p1chr18:
CGexonicMaternalnonsynonymous SNVNM_030632c.C5171Gp.T1724S3.603-Guo2018 T
ASXL3     GX0180.p1chr18:
CGexonicMaternalnonsynonymous SNVNM_030632c.C4520Gp.T1507R12.83-Guo2018 T
ASXL3     SP0007002chr18:
TTATCCexonicDe novoframeshift insertionNM_030632c.5969_5970insATCCp.L1990fs--Feliciano2019 E
Fu2022 E
Trost2022 G
Zhou2022 GE
ASXL3     HEN0252.p1chr18:
GAexonicUnknownnonsynonymous SNVNM_030632c.G2455Ap.A819T0.0468.328E-6Guo2018 T
ASXL3     HEN0294.p1chr18:
AGexonicUnknownnonsynonymous SNVNM_030632c.A1381Gp.S461G12.64-Guo2018 T
ASXL3     M23834chr18:
CC/GexonicDe novo--Guo2018 T
ASXL3     2-1389-003chr18:
TCintronicDe novo--Yuen2017 G
ASXL3     AGRE_AU1244301chr18:
GAsplicingUnknownsplicing15.16-Wang2020 T
ASXL3     JS0003.p1chr18:
CC/TexonicDe novo--Guo2018 T
ASXL3     1-0458-005chr18:
GAintronicDe novo--Trost2022 G
Yuen2017 G
ASXL3     A0021chr18:
ACAAexonicDe novoframeshift deletionNM_030632c.1897_1898delp.Q633fs--Xiong2019 ET
ASXL3     Wang2023:422chr18:
GTexonicDe novostopgainNM_030632c.G1570Tp.E524X15.06-Wang2023 E
ASXL3     SF0096551.p2chr18:
TGexonicstopgainNM_030632c.T2801Gp.L934X18.12-Wang2020 T
ASXL3     SF0136734.p1chr18:
TACAGTexonicframeshift deletionNM_030632c.1975_1978delp.T659fs--Wang2020 T
ASXL3     SP0046243 Complex Event; expand row to view variants  frameshift insertion, frameshift substitutionNM_030632
--Antaki2022 GE
Zhou2022 GE
ASXL3     SF0108176.p1chr18:
TAAAGTexonicframeshift deletionNM_030632c.3748_3751delp.K1250fs--Wang2020 T
ASXL3     SF0106896.p1chr18:
TGexonicstopgainNM_030632c.T2801Gp.L934X18.12-Wang2020 T
ASXL3     SP0108176chr18:
TAAAGTexonicDe novoframeshift deletionNM_030632c.3748_3751delp.K1250fs--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ASXL3     SP0136734chr18:
TACAGTexonicDe novoframeshift deletionNM_030632c.1975_1978delp.T659fs--Antaki2022 GE
Fu2022 E
Trost2022 G
Zhou2022 GE
ASXL3     M20692chr18:
ACexonicPaternalnonsynonymous SNVNM_030632c.A1100Cp.E367A14.69.194E-6Guo2018 T
ASXL3     M08419chr18:
CTexonicPaternalnonsynonymous SNVNM_030632c.C587Tp.S196L19.349.252E-5Guo2018 T
ASXL3     M19810chr18:
TAexonicPaternalnonsynonymous SNVNM_030632c.T1960Ap.S654T18.871.692E-5Guo2018 T
ASXL3     M12510chr18:
TCexonicPaternalnonsynonymous SNVNM_030632c.T1475Cp.I492T0.024-Guo2018 T
ASXL3     M23227chr18:
AGexonicPaternalnonsynonymous SNVNM_030632c.A73Gp.N25D16.17-Guo2018 T
ASXL3     SF0010005.p1chr18:
CGexonicstopgainNM_030632c.C4322Gp.S1441X42.0-Wang2020 T
ASXL3     M12362chr18:
CC/GexonicPaternal--Guo2018 T
ASXL3     M08509chr18:
CTexonicPaternalnonsynonymous SNVNM_030632c.C257Tp.S86L24.3-Guo2018 T
ASXL3     M18388chr18:
TCexonicPaternalnonsynonymous SNVNM_030632c.T3976Cp.S1326P1.1837.459E-5Guo2018 T
ASXL3     M02363chr18:
AGexonicPaternalnonsynonymous SNVNM_030632c.A3946Gp.S1316G7.313-Guo2018 T
ASXL3     20705-32533chr18:
CAAAACexonicframeshift deletionNM_030632c.4889_4892delp.Q1630fs--Callaghan2019 G
ASXL3     M16056chr18:
CTexonicPaternalnonsynonymous SNVNM_030632c.C4652Tp.T1551I0.05-Guo2018 T
ASXL3     M13413chr18:
TAexonicPaternalnonsynonymous SNVNM_030632c.T4442Ap.L1481Q17.51-Guo2018 T
ASXL3     M08781chr18:
GCexonicPaternalnonsynonymous SNVNM_030632c.G3276Cp.E1092D16.76-Guo2018 T
ASXL3     M12434chr18:
GAexonicPaternalnonsynonymous SNVNM_030632c.G2461Ap.E821K11.57-Guo2018 T
ASXL3     M04453chr18:
CTexonicPaternalnonsynonymous SNVNM_030632c.C3797Tp.S1266F18.98-Guo2018 T
ASXL3     M08512chr18:
CGexonicPaternalnonsynonymous SNVNM_030632c.C3688Gp.L1230V17.29-Guo2018 T
ASXL3     M19612chr18:
TCexonicPaternalnonsynonymous SNVNM_030632c.T6449Cp.L2150P14.478.282E-6Guo2018 T
ASXL3     M15039chr18:
GAexonicPaternalnonsynonymous SNVNM_030632c.G6220Ap.G2074S9.8547.551E-5Guo2018 T
ASXL3     M16056chr18:
CGexonicPaternalnonsynonymous SNVNM_030632c.C5375Gp.P1792R8.392-Guo2018 T
ASXL3     M19639chr18:
GCexonicPaternalnonsynonymous SNVNM_030632c.G4905Cp.E1635D8.5272.522E-5Guo2018 T
ASXL3     M08626chr18:
CGexonicPaternalnonsynonymous SNVNM_030632c.C5788Gp.Q1930E13.968.298E-6Guo2018 T
ASXL3     M10141chr18:
CGexonicPaternalnonsynonymous SNVNM_030632c.C5788Gp.Q1930E13.968.298E-6Guo2018 T
ASXL3     2-1709-003chr18:
CTexonicDe novostopgainNM_030632c.C4906Tp.Q1636X38.0-Trost2022 G
Wang2020 T
Yuen2017 G
Zhou2022 GE
ASXL3     Hu2022:82chr18:
GAexonicMaternalnonsynonymous SNVNM_030632c.G3136Ap.G1046R14.832.517E-5Hu2022 T
ASXL3     Mahjani2021:85chr18:
TCATexonicframeshift deletionNM_030632c.4209_4210delp.V1403fs--Mahjani2021 E
ASXL3     217-14320-4340chr18:
CTexonicUnknownnonsynonymous SNVNM_030632c.C3526Tp.R1176W20.24.157E-5Stessman2017 T
ASXL3     Wang2023:495chr18:
CTexonicDe novostopgainNM_030632c.C4399Tp.R1467X40.0-Wang2023 E
ASXL3     DEASD_3018_001chr18:
GCTCAGAAGCCAGCTTGGACGexonicDe novoframeshift deletionNM_030632c.4479_4497delp.S1493fs--Fu2022 E
ASXL3     1000262100274511-Cchr18:
CTexonicDe novosynonymous SNVNM_030632c.C1134Tp.N378N-4.336E-5Fu2022 E
ASXL3     200675499_1082035007chr18:
CTexonicDe novosynonymous SNVNM_030632c.C52Tp.L18L--Fu2022 E
ASXL3     SD0008.p1chr18:
GAexonicMaternalnonsynonymous SNVNM_030632c.G2455Ap.A819T0.0468.328E-6Guo2018 T
ASXL3     SD0061.p1chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C257Tp.S86L24.3-Guo2018 T
ASXL3     AU3646301chr18:
GCintronicDe novo--Yuen2017 G
ASXL3     Cukier2014:37425chr18:
TGexonicUnknownnonsynonymous SNVNM_030632c.T6200Gp.L2067R16.010.0063Cukier2014 E
ASXL3     1-0558-003chr18:
CTintronicDe novo--Trost2022 G
Yuen2017 G
ASXL3     ACGC_GX0024.p1chr18:
CTexonicMaternalnonsynonymous SNVNM_030632c.C3178Tp.R1060W17.88.402E-6Wang2020 T
Source Variant Information

, -


Paper alias:

No records found.
Paper Information
Variant source
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView