or
or
Exact

Results for "CTNND2"

Variant Events: 155

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
CTNND2     AU4264302chr5:
11083187-11083187
AGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     Stessman2017:ASD_1169chr5:
11159769-11159769
CTexonicUnknownstopgainNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1067A
c.G1805A
c.G779A
c.G2078A
p.W356X
p.W602X
p.W260X
p.W693X
43.0-Stessman2017 T
CTNND2     1-0375-003chr5:
11164619-11164619
CTintronicDe novo--Yuen2016 G
CTNND2     2-1180-003chr5:
12094709-12094709
AGintergenicDe novo--Yuen2016 G
Yuen2017 G
CTNND2     AU056803chr5:
12007549-12007549
ATintergenicDe novo--Yuen2017 G
CTNND2     2-1690-003chr5:
12444643-12444643
AGintergenicDe novo--Yuen2017 G
CTNND2     2-1507-003chr5:
11638248-11638248
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     A22chr5:
12307991-12307991
AGintergenicDe novo--Wu2018 G
CTNND2     AU3840302chr5:
12398663-12398663
CTintergenicDe novo--Yuen2017 G
CTNND2     1-0155-003chr5:
12492432-12492432
CGintergenicDe novo--Yuen2017 G
CTNND2     2-1185-003chr5:
11561412-11561412
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     11328.p1chr5:
11175102-11175109
TCTATTAATintronicDe novo--Werling2018 G
CTNND2     1-0075-003chr5:
11537130-11537130
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-1288-003chr5:
12264499-12264499
GAintergenicDe novo--Yuen2017 G
CTNND2     1-0200-004chr5:
11096450-11096450
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     5-5153-003chr5:
11013112-11013112
TCintronicDe novo--Trost2022 G
CTNND2     3-0526-000chr5:
11038657-11038657
ACintronicDe novo--Trost2022 G
CTNND2     1-0394-003chr5:
11753695-11753695
TGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU017304chr5:
12069673-12069673
GAintergenicDe novo--Yuen2017 G
CTNND2     2-1757-003chr5:
10986385-10986385
TCintronicDe novo--Trost2022 G
CTNND2     1-0138-003chr5:
11003947-11003947
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     4-0039-003chr5:
11162857-11162859
GAGTTTintronicDe novo--Trost2022 G
CTNND2     7-0342-005chr5:
11175497-11175497
TGintronicDe novo--Trost2022 G
CTNND2     1-1044-003chr5:
11125891-11125891
CTintronicDe novo--Trost2022 G
CTNND2     1-0147-003chr5:
11162857-11162859
GAGTTTintronicDe novo--Trost2022 G
CTNND2     MSSNG00129-003chr5:
11102843-11102843
CTintronicDe novo--Trost2022 G
CTNND2     3-0873-000chr5:
11109576-11109576
AGintronicDe novo--Trost2022 G
CTNND2     1031chr5:
11057478-11057478
GAintronicDe novo--Trost2022 G
CTNND2     1-0654-003chr5:
11066878-11066878
GAintronicDe novo--Trost2022 G
CTNND2     AU3779301chr5:
11326116-11326116
TCintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-1458-003chr5:
11285978-11285981
TATGAGAGAGCACintronicDe novo--Trost2022 G
CTNND2     AU3517301chr5:
12202592-12202592
GAintergenicDe novo--Yuen2017 G
CTNND2     5-0009-003chr5:
11291247-11291247
GAintronicDe novo--Trost2022 G
CTNND2     MSSNG00134-003chr5:
11232134-11232134
GAintronicDe novo--Trost2022 G
CTNND2     1-1011-003chr5:
11268595-11268595
TTGintronicDe novo--Trost2022 G
CTNND2     2-1294-003chr5:
11227818-11227822
AGGTATTCTGintronicDe novo--Trost2022 G
CTNND2     AU1640302chr5:
10998068-10998068
CGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-1294-004chr5:
11227818-11227822
AGGTATTCTGintronicDe novo--Trost2022 G
CTNND2     REACH000154chr5:
11183792-11183792
CTintronicDe novo--Trost2022 G
CTNND2     MSSNG00045-005chr5:
11205104-11205104
TAintronicDe novo--Trost2022 G
CTNND2     A5chr5:
12330667-12330667
TGintergenicDe novo--Wu2018 G
CTNND2     REACH000229chr5:
11492649-11492649
AGintronicDe novo--Trost2022 G
CTNND2     2-1766-003chr5:
11524216-11524216
CCAGGintronicDe novo--Trost2022 G
CTNND2     AU4032306chr5:
11850449-11850449
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     7-0303-003chr5:
11445624-11445624
CTintronicDe novo--Trost2022 G
CTNND2     AU3900302chr5:
11548608-11548608
TGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     REACH000319chr5:
11491286-11491286
GAintronicDe novo--Trost2022 G
CTNND2     5-0009-003chr5:
11391838-11391838
AGintronicDe novo--Trost2022 G
CTNND2     3-0070-000chr5:
11395355-11395355
GAintronicDe novo--Trost2022 G
CTNND2     2-1106-004chr5:
11293126-11293126
CTintronicDe novo--Trost2022 G
CTNND2     7-0219-003chr5:
12185045-12185045
CAintergenicDe novo--Yuen2017 G
CTNND2     MT_54.3chr5:
11381806-11381806
GAintronicDe novo--Trost2022 G
CTNND2     MSSNG00100-003chr5:
11627033-11627034
TGTintronicDe novo--Trost2022 G
CTNND2     1032chr5:
11628048-11628048
GAintronicDe novo--Trost2022 G
CTNND2     2-1433-003chr5:
11593230-11593230
GAintronicDe novo--Trost2022 G
CTNND2     M23212chr5:
11022936-11022936
GAexonicUnknownnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1933T
c.C2671T
c.C1645T
c.C2944T
p.R645W
p.R891W
p.R549W
p.R982W
19.171.648E-5Stessman2017 T
CTNND2     1-1103-003chr5:
11626028-11626028
GAintronicDe novo--Trost2022 G
CTNND2     REACH000349chr5:
11555481-11555481
TCintronicDe novo--Trost2022 G
CTNND2     REACH000668chr5:
11572760-11572760
GAintronicDe novo--Trost2022 G
CTNND2     2-1522-003chr5:
12496416-12496416
TCintergenicDe novo--Yuen2017 G
CTNND2     REACH000718chr5:
11527940-11527940
GAintronicDe novo--Trost2022 G
CTNND2     5-5046-007chr5:
11538206-11538206
TGintronicDe novo--Trost2022 G
CTNND2     SP0141690chr5:
11384920-11384920
GCexonicDe novononsynonymous SNVNM_001288715
NM_001332
c.C761G
c.C1034G
p.P254R
p.P345R
23.8-Fu2022 E
Trost2022 G
Zhou2022 GE
CTNND2     1-0164-003chr5:
11022976-11022976
GAexonicsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1893T
c.C2631T
c.C1605T
c.C2904T
p.H631H
p.H877H
p.H535H
p.H968H
-4.943E-5Zhou2022 GE
CTNND2     1-0037-004chr5:
11765547-11765547
AGintronicDe novo--Trost2022 G
CTNND2     SP0125315chr5:
11082841-11082841
TCexonicDe novononsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.A1744G
c.A2482G
c.A1456G
c.A2755G
p.M582V
p.M828V
p.M486V
p.M919V
23.1-Fu2022 E
Trost2022 G
Zhou2022 GE
CTNND2     1-0350-003chr5:
11773885-11773885
TCintronicDe novo--Trost2022 G
CTNND2     SP0072995chr5:
11082978-11082978
GAintronicDe novo-8.418E-5Fu2022 E
Trost2022 G
CTNND2     MSSNG00232-003chr5:
11738174-11738174
GAintronicDe novo--Trost2022 G
CTNND2     1-0305-004chr5:
11130923-11130923
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU4197302chr5:
11463752-11463752
AGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     SP0081142chr5:
11904091-11904091
GCUTR5De novo--Fu2022 E
CTNND2     1-1045-003chr5:
11749880-11749880
GTintronicDe novo--Trost2022 G
CTNND2     AU1352302chr5:
11111014-11111014
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1408A
c.G2146A
c.G1120A
c.G2419A
p.G470R
p.G716R
p.G374R
p.G807R
32.0-Stessman2017 T
CTNND2     5-1042-003chr5:
11641806-11641806
GAintronicDe novo--Trost2022 G
CTNND2     2-1245-003chr5:
11910882-11910882
CTintergenicDe novo--Yuen2017 G
CTNND2     7-0497-003chr5:
11643259-11643259
GAintronicDe novo--Trost2022 G
CTNND2     2-1811-004chr5:
11629106-11629106
GAintronicDe novo--Trost2022 G
CTNND2     AU056204chr5:
11112614-11112614
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-1175-003chr5:
11641770-11641770
AGintronicDe novo--Trost2022 G
CTNND2     7-0408-003chr5:
11877114-11877114
CAintronicDe novo--Trost2022 G
CTNND2     3-0515-001chr5:
11886294-11886294
GAintronicDe novo--Trost2022 G
CTNND2     REACH000097chr5:
11866415-11866415
TTAintronicDe novo--Trost2022 G
CTNND2     7-0198-003chr5:
11866472-11866472
AATintronicDe novo--Trost2022 G
CTNND2     211-5259-3chr5:
10992686-10992686
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G2177A
c.G2915A
c.G1889A
c.G3188A
p.R726H
p.R972H
p.R630H
p.R1063H
34.09.086E-5Stessman2017 T
CTNND2     3-0475-000chr5:
11854583-11854583
TGintronicDe novo--Trost2022 G
CTNND2     5-5237-005chr5:
11856771-11856771
AGintronicDe novo--Trost2022 G
CTNND2     REACH000293chr5:
11812605-11812605
CAintronicDe novo--Trost2022 G
CTNND2     1-1129-003chr5:
11838031-11838031
TCintronicDe novo--Trost2022 G
CTNND2     2-1085-003chr5:
10985796-10985796
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU3911301chr5:
12048049-12048049
CTintergenicDe novo--Yuen2017 G
CTNND2     5-0025-004chr5:
11527584-11527584
CGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     M21665chr5:
11159760-11159760
GAexonicUnknownnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1076T
c.C1814T
c.C788T
c.C2087T
p.S359L
p.S605L
p.S263L
p.S696L
34.0-Guo2018 T
CTNND2     1-0007-003chr5:
11481791-11481806
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintronicDe novo--Yuen2017 G
CTNND2     MSSNG00212-003chr5:
11887943-11887943
TCintronicDe novo--Trost2022 G
CTNND2     1-0007-003chr5:
12550929-12550929
CGintergenicDe novo--Yuen2017 G
CTNND2     1-0567-004chr5:
11968365-11968365
AGintergenicDe novo--Yuen2017 G
CTNND2     AU2333302chr5:
11277321-11277321
AGintronicDe novo--Yuen2017 G
CTNND2     1-0567-004chr5:
11140714-11140714
CCCAAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU4176302chr5:
11641931-11641931
TCintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU2215302chr5:
11985809-11985809
GTintergenicDe novo--Yuen2017 G
CTNND2     2-1223-003chr5:
11086579-11086579
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-0161-003chr5:
12564753-12564753
GAintergenicDe novo--Yuen2017 G
CTNND2     2-0219-004chr5:
11271632-11271632
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-0126-003chr5:
12266785-12266785
CTintergenicDe novo--Yuen2017 G
CTNND2     1-0673-003chr5:
12564296-12564296
GCintergenicDe novo--Yuen2017 G
CTNND2     1-0591-003chr5:
12180586-12180586
TCintergenicDe novo--Yuen2017 G
CTNND2     11010.p1chr5:
12038021-12038021
GAintergenicDe novo--Werling2018 G
CTNND2     74-0688chr5:
11405109-11405109
GAintronicDe novo--Michaelson2012 G
CTNND2     1-0493-003chr5:
11519849-11519849
AGintronicDe novo--Yuen2016 G
Yuen2017 G
CTNND2     1-0139-005chr5:
11257007-11257007
TTTTATGTTATGCATAAATGintronicDe novo--Yuen2017 G
CTNND2     M30910chr5:
11159760-11159760
GAexonicMaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1076T
c.C1814T
c.C788T
c.C2087T
p.S359L
p.S605L
p.S263L
p.S696L
34.0-Guo2018 T
CTNND2     AU1894303chr5:
12149720-12149720
CTintergenicDe novo--Yuen2017 G
CTNND2     AU2156303chr5:
12045853-12045853
TCintergenicDe novo--Yuen2017 G
CTNND2     2-1561-003chr5:
11475054-11475054
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU2525302chr5:
11784440-11784440
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-0116-005chr5:
11920087-11920087
CGintergenicDe novo--Yuen2017 G
CTNND2     2-1362-004chr5:
11093423-11093423
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-1368-003chr5:
11846154-11846154
TCintronicDe novo--Trost2022 G
Yuen2016 G
Yuen2017 G
CTNND2     200675360@1082034754chr5:
11082977-11082977
CTintronicDe novo-4.207E-5Satterstrom2020 E
Trost2022 G
CTNND2     AU3649305chr5:
11064264-11064264
AGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-0246-004chr5:
11491792-11491792
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-1362-004chr5:
11257007-11257007
TTTTATGTTATGCATAAATGintronicDe novo--Yuen2017 G
CTNND2     1-0448-003chr5:
11807597-11807597
TCintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-1506-003chr5:
11490406-11490406
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-0385-003 Complex Event; expand row to view variants  De novo--Trost2022 G
Yuen2017 G
CTNND2     08C76383chr5:
11022976-11022976
GAexonicDe novosynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1893T
c.C2631T
c.C1605T
c.C2904T
p.H631H
p.H877H
p.H535H
p.H968H
-4.943E-5Fu2022 E
Satterstrom2020 E
Trost2022 G
Zhou2022 GE
CTNND2     M27815chr5:
11159760-11159760
GAexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.C1076T
c.C1814T
c.C788T
c.C2087T
p.S359L
p.S605L
p.S263L
p.S696L
34.0-Guo2018 T
Wang2016 T
CTNND2     2-0070-004chr5:
11313549-11313549
TGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-0381-003chr5:
11673583-11673583
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU005213chr5:
12497829-12497829
GAintergenicDe novo--Yuen2017 G
CTNND2     GX0032.p1chr5:
11565129-11565129
CTexonicPaternalnonsynonymous SNVNM_001332c.G214Ap.E72K36.0-Guo2018 T
CTNND2     2-1508-004chr5:
11644644-11644644
GTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     5-0004-003chr5:
12433658-12433658
TTATTTTCintergenicDe novo--Yuen2017 G
CTNND2     13385.p1chr5:
11477241-11477241
CTintronicDe novo--Wilfert2021 G
CTNND2     2-1376-003chr5:
12140258-12140258
CAintergenicDe novo--Yuen2016 G
Yuen2017 G
CTNND2     5-0083-003chr5:
11467641-11467641
GAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-0161-004chr5:
12564753-12564753
GAintergenicDe novo--Yuen2017 G
CTNND2     2-1427-003chr5:
11093778-11093778
TCintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU069603chr5:
11734717-11734717
TGintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU3190305chr5:
11558593-11558593
TAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-0201-005chr5:
12182328-12182328
CTintergenicDe novo--Yuen2017 G
CTNND2     300449chr5:
11412182-11412183
CTTsplicingInheritedsplicing--Stessman2017 T
CTNND2     AU009904chr5:
11244201-11244201
TCintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-1605-004chr5:
11603202-11603202
TCintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     1-0568-003chr5:
12502990-12502990
TCintergenicDe novo--Yuen2017 G
CTNND2     AU3900301chr5:
11345118-11345118
CAintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     05C50297chr5:
11111014-11111014
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1408A
c.G2146A
c.G1120A
c.G2419A
p.G470R
p.G716R
p.G374R
p.G807R
32.0-Stessman2017 T
CTNND2     3-0224-000chr5:
10992756-10992761
ACGAGGAexonicUnknownframeshift deletionNM_001288716
NM_001288715
NM_001288717
NM_001332
c.2102_2106del
c.2840_2844del
c.1814_1818del
c.3113_3117del
p.A701fs
p.A947fs
p.A605fs
p.A1038fs
--Chan2022 G
CTNND2     5-0137-003chr5:
12316702-12316702
ACintergenicDe novo--Yuen2017 G
CTNND2     AU3702307chr5:
11723781-11723781
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     AU3790302chr5:
11090080-11090080
CTintronicDe novo--Trost2022 G
Yuen2017 G
CTNND2     2-1280-003chr5:
12102299-12102299
TCintergenicDe novo--Yuen2017 G
CTNND2     1-0009-004chr5:
12253820-12253820
AGintergenicDe novo--Yuen2017 G
CTNND2     M15228chr5:
11098857-11098857
CTexonicPaternalnonsynonymous SNVNM_001288716
NM_001288715
NM_001288717
NM_001332
c.G1456A
c.G2194A
c.G1168A
c.G2467A
p.D486N
p.D732N
p.D390N
p.D823N
32.0-Guo2018 T
Wang2016 T
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More