or
or
Exact

Results for "SLIT3"

Variant Events: 56

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
SLIT3     5-0140-003chr5:
168807032-168807032
TCintergenicDe novo--Yuen2017 G
SLIT3     AU4033303chr5:
168840538-168840538
GAintergenicDe novo--Yuen2017 G
SLIT3     PN400543chr5:
168151427-168151427
GAexonicUnknownnonsynonymous SNVNM_001271946
NM_003062
c.C2333T
c.C2333T
p.T778M
p.T778M
20.36.0E-4Leblond2019 E
SLIT3     1-0049-004chr5:
168526713-168526713
GGGTCATintronicDe novo--Yuen2017 G
SLIT3     1-0763-004chr5:
168650286-168650286
GAintronicDe novo--Yuen2017 G
SLIT3     AU075207chr5:
168318986-168318986
CTintronicDe novo--Yuen2017 G
SLIT3     AU2139301chr5:
168667031-168667031
ACintronicDe novo--Yuen2017 G
SLIT3     AU2156303chr5:
168854107-168854107
TAintergenicDe novo--Yuen2017 G
SLIT3     PN400551chr5:
168151427-168151427
GAexonicUnknownnonsynonymous SNVNM_001271946
NM_003062
c.C2333T
c.C2333T
p.T778M
p.T778M
20.36.0E-4Leblond2019 E
SLIT3     AU4079301chr5:
168362074-168362074
TGintronicDe novo--Yuen2017 G
SLIT3     2-0122-004chr5:
168148791-168148791
CTintronicDe novo--Yuen2017 G
SLIT3     1-0567-003chr5:
168477232-168477236
CAGTTCintronicDe novo--Yuen2017 G
SLIT3     2-0144-003chr5:
168697362-168697362
CTintronicDe novo--Yuen2017 G
SLIT3     5-0014-003chr5:
168704104-168704104
TGintronicDe novo--Yuen2017 G
SLIT3     2-1272-003chr5:
168175351-168175351
CAexonicDe novosynonymous SNVNM_001271946
NM_003062
c.G2226T
c.G2226T
p.G742G
p.G742G
--Jiang2013 G
Yuen2016 G
SLIT3     1-0046-003chr5:
168088732-168088732
CTdownstreamDe novo--Yuen2016 G
Yuen2017 G
SLIT3     11452.p1chr5:
168678421-168678421
GAexonicMosaicsynonymous SNVNM_001271946
NM_003062
c.C240T
c.C240T
p.D80D
p.D80D
--Krupp2017 E
SLIT3     09C80136chr5:
168112800-168112800
GAexonicDe novosynonymous SNVNM_001271946
NM_003062
c.C3468T
c.C3447T
p.F1156F
p.F1149F
--DeRubeis2014 E
Kosmicki2017 E
Lim2017 E
Satterstrom2020 E
SLIT3     2-1391-003chr5:
168182453-168182453
TTCintronicDe novo--Yuen2017 G
SLIT3     PN400544chr5:
168151427-168151427
GAexonicUnknownnonsynonymous SNVNM_001271946
NM_003062
c.C2333T
c.C2333T
p.T778M
p.T778M
20.36.0E-4Leblond2019 E
SLIT3     1-0330-003chr5:
168098932-168098937
GAGATAGintronicDe novo--Yuen2017 G
SLIT3     2-1266-003chr5:
168565095-168565095
AGintronicDe novo--Yuen2017 G
SLIT3     PN400532chr5:
168151427-168151427
GAexonicUnknownnonsynonymous SNVNM_001271946
NM_003062
c.C2333T
c.C2333T
p.T778M
p.T778M
20.36.0E-4Leblond2019 E
SLIT3     AU3907301chr5:
168246745-168246753
GATTCTATTGATTCTATTCTATTintronicDe novo--Yuen2017 G
SLIT3     2-0070-004chr5:
168543355-168543355
CTintronicDe novo--Yuen2017 G
SLIT3     111309chr5:
168233455-168233455
CTexonicnonsynonymous SNVNM_001271946
NM_003062
c.G931A
c.G931A
p.E311K
p.E311K
35.0-Woodbury-Smith2022 E
SLIT3     ASDFI_1007chr5:
168149917-168149917
AGintronicDe novo--Satterstrom2020 E
SLIT3     2-1731-003chr5:
168705674-168705679
TGAGAGTGAGintronicDe novo--Yuen2017 G
SLIT3     PN400533chr5:
168151427-168151427
GAexonicUnknownnonsynonymous SNVNM_001271946
NM_003062
c.C2333T
c.C2333T
p.T778M
p.T778M
20.36.0E-4Leblond2019 E
SLIT3     13539.p1chr5:
168469728-168469728
CTintronicDe novo--Turner2016 G
SLIT3     2-0319-004chr5:
168173847-168173847
TCintronicDe novo--Yuen2017 G
SLIT3     2-1454-003chr5:
168094115-168094118
GCCTGCCTCCTintronicDe novo--Yuen2017 G
SLIT3     2-1376-003chr5:
168420390-168420390
GAintronicDe novo--Yuen2016 G
Yuen2017 G
SLIT3     2-1562-004chr5:
168378030-168378030
ACintronicDe novo--Yuen2017 G
SLIT3     AU4013303chr5:
168389504-168389504
AGintronicDe novo--Yuen2017 G
SLIT3     AU4435301chr5:
168333580-168333580
GAintronicDe novo--Yuen2017 G
SLIT3     2-0012-003chr5:
168089203-168089203
GAUTR3De novo--Yuen2017 G
SLIT3     2-1562-004chr5:
168088296-168088296
ACdownstreamDe novo--Yuen2017 G
SLIT3     14315.p1chr5:
168838250-168838250
CTintergenicDe novo--Wilfert2021 G
SLIT3     Cukier2014:18074chr5:
168180047-168180047
CTexonicUnknownnonsynonymous SNVNM_001271946
NM_003062
c.G1886A
c.G1886A
p.S629N
p.S629N
16.110.007Cukier2014 E
SLIT3     1-0329-004chr5:
168990001-168990001
CTintergenicDe novo--Yuen2017 G
SLIT3     2-1407-003chr5:
168575008-168575008
GAintronicDe novo--Yuen2016 G
Yuen2017 G
SLIT3     1-0433-003chr5:
168395065-168395065
ATintronicDe novo--Yuen2017 G
SLIT3     2-1644-003chr5:
168473996-168473996
TAintronicDe novo--Yuen2017 G
SLIT3     Cukier2014:17342chr5:
168180047-168180047
CTexonicUnknownnonsynonymous SNVNM_001271946
NM_003062
c.G1886A
c.G1886A
p.S629N
p.S629N
16.110.007Cukier2014 E
SLIT3     AU2427303chr5:
168259896-168259896
GAintronicDe novo--Yuen2017 G
SLIT3     1-0104-004chr5:
168475361-168475361
CAintronicDe novo--Yuen2017 G
SLIT3     AU3368302chr5:
168735086-168735086
TCintergenicDe novo--Yuen2017 G
SLIT3     AU3605304chr5:
168509795-168509795
GAintronicDe novo--Yuen2017 G
SLIT3     1-0520-003chr5:
168235865-168235865
GAintronicDe novo--Yuen2016 G
Yuen2017 G
SLIT3     1-0755-003chr5:
168208505-168208505
GAintronicDe novo--Yuen2017 G
SLIT3     1-0353-003chr5:
168222990-168222990
GCintronicDe novo--Yuen2017 G
SLIT3     2-1086-004chr5:
168404923-168404923
ACintronicDe novo--Yuen2017 G
SLIT3     AU3915301chr5:
168662990-168662990
AGintronicDe novo--Yuen2017 G
SLIT3     1-0567-004chr5:
168477232-168477236
CAGTTCintronicDe novo--Yuen2017 G
SLIT3     2-1223-003chr5:
168779365-168779365
ACintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More