or
or
Exact

Results for "NR0B1"

Variant Events: 12

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NR0B1     2-1266-003chrX:
30327222-30327222
CAexonicDe novononsynonymous SNVNM_000475c.G259Tp.A87S16.21-Jiang2013 G
Yuen2017 G
NR0B1     AU4067303chrX:
30442537-30442537
CTintergenicDe novo--Yuen2017 G
NR0B1     1-0552-003chrX:
30405758-30405758
TGintergenicDe novo--Yuen2017 G
NR0B1     1-0923-003chrX:
30414889-30414889
TAintergenicDe novo--Yuen2017 G
NR0B1     AU2089302chrX:
30490309-30490309
GAintergenicDe novo--Yuen2017 G
NR0B1     AU4410302chrX:
30521773-30521773
GCintergenicDe novo--Yuen2017 G
NR0B1     09C99821chrX:
30327222-30327222
CAexonicDe novononsynonymous SNVNM_000475c.G259Tp.A87S16.21-Satterstrom2020 E
NR0B1     AU1848302chrX:
30498481-30498481
AGintergenicDe novo--Yuen2017 G
NR0B1     5-0106-003chrX:
30558212-30558249
GAGAAGAAGAAGGAAGAAGAAGAAGGAAGAAGAAGAAGGAGAAGAAGAAGGAAGAAGAAGAAGintergenicDe novo--Yuen2017 G
NR0B1     1-0661-003chrX:
30351854-30351865
CATATATATATACATATATATATATAintergenicDe novo--Yuen2017 G
NR0B1     AU2137304chrX:
30490455-30490476
AAAAAAAAAAACAAAAAAAAAAAAAAAAAAAAAintergenicDe novo--Yuen2017 G
NR0B1     AU2215302chrX:
30564891-30564891
CTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More