or
or
Exact

Results for "POU3F4"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
POU3F4     1-0162-004chrX:
82857425-82857425
ATintergenicDe novo--Yuen2017 G
POU3F4     2-1327-004chrX:
82822063-82822063
CTintergenicDe novo--Yuen2017 G
POU3F4     7-0219-003chrX:
82977303-82977321
TTTTTTTTTTTTTTTTTTGTintergenicDe novo--Yuen2017 G
POU3F4     12867.p1chrX:
82764134-82764134
AGexonicDe novononsynonymous SNVNM_000307c.A802Gp.S268G12.37-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
POU3F4     12594.p1chrX:
82764282-82764282
TCexonicMosaicnonsynonymous SNVNM_000307c.T950Cp.L317S18.8-Krupp2017 E
POU3F4     AU005214chrX:
82879793-82879801
ATTTTTTTTATTTTTTTintergenicDe novo--Yuen2017 G
POU3F4     1-0553-003chrX:
82922326-82922326
GCintergenicDe novo--Yuen2017 G
POU3F4     1-0591-003chrX:
82815966-82815986
TGTGTGTGTGTGCGTGTGTGTTGTGTGTGTintergenicDe novo--Yuen2017 G
POU3F4     7-0253-004chrX:
82871512-82871512
GAintergenicDe novo--Yuen2017 G
POU3F4     1-0965-003chrX:
82993936-82993943
AGAGAGAGAGAGAGAGCGAGAGAGintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More