or
or
Exact

Results for "EPHX2"

Variant Events: 10

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
EPHX2     AU063005chr8:
27411322-27411322
CTintergenicDe novo--Yuen2017 G
EPHX2     12243.p1chr8:
27362614-27362614
CTexonicDe novononsynonymous SNVNM_001256483
NM_001256482
NM_001256484
NM_001979
c.C290T
c.C329T
c.C329T
c.C488T
p.P97L
p.P110L
p.P110L
p.P163L
12.92-Iossifov2012 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Krupp2017 E
Satterstrom2020 E
EPHX2     1-0636-003chr8:
27440447-27440465
GTTATTTATTTATTTATTTGTTATTTATTTATTTintergenicDe novo--Yuen2017 G
EPHX2     1-0138-003chr8:
27384619-27384619
GAintronicDe novo--Yuen2017 G
EPHX2     iHART1704chr8:
27399050-27399058
GGGACGGAAGexonicMaternalframeshift deletionNM_001256483
NM_001256482
NM_001256484
NM_001979
c.1243_1250del
c.1282_1289del
c.1282_1289del
c.1441_1448del
p.G415fs
p.G428fs
p.G428fs
p.G481fs
--Ruzzo2019 G
EPHX2     2-1223-003chr8:
27381852-27381852
TAintronicDe novo--Yuen2017 G
EPHX2     iHART3105chr8:
27361123-27361123
GAexonicPaternalstopgainNM_001256482
NM_001256484
NM_001979
c.G30A
c.G30A
c.G189A
p.W10X
p.W10X
p.W63X
20.72.0E-4Ruzzo2019 G
EPHX2     iHART1705chr8:
27399050-27399058
GGGACGGAAGexonicMaternalframeshift deletionNM_001256483
NM_001256482
NM_001256484
NM_001979
c.1243_1250del
c.1282_1289del
c.1282_1289del
c.1441_1448del
p.G415fs
p.G428fs
p.G428fs
p.G481fs
--Ruzzo2019 G
EPHX2     A29chr8:
27387126-27387126
AGintronicDe novo--Wu2018 G
EPHX2     SSC04967chr8:
27362614-27362614
CTexonicDe novononsynonymous SNVNM_001256483
NM_001256482
NM_001256484
NM_001979
c.C290T
c.C329T
c.C329T
c.C488T
p.P97L
p.P110L
p.P110L
p.P163L
12.92-Lim2017 E
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More