or
or
Exact

Results for "PRKDC"

Variant Events: 22

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
PRKDC     2-1514-003chr8:
48739361-48739361
CGexonicDe novounknown7.452-Yuen2017 G
PRKDC     12266.p1chr8:
48827944-48827944
CAexonicDe novo, Mosaicunknown17.63-Dou2017 E
Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Wilfert2021 G
PRKDC     11839.p1chr8:
48849076-48849076
GAexonicDe novounknown20.24.15E-5Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
PRKDC     13451.p1chr8:
48852146-48852146
AGexonicDe novounknown21.0-Iossifov2014 E
Ji2016 E
Kosmicki2017 E
Satterstrom2020 E
Wilfert2021 G
PRKDC     68655chr8:
48849076-48849076
GAexonicDe novounknown20.24.15E-5Fu2022 E
PRKDC     2-1235-004chr8:
48764279-48764279
TGintronicDe novo--Yuen2017 G
PRKDC     11420.p1chr8:
48730085-48730085
CTexonicMosaicunknown--Dou2017 E
PRKDC     1-0305-004chr8:
48804008-48804008
GAintronicDe novo--Yuen2017 G
PRKDC     NDAR_INVPA848HA2_wes1chr8:
48710841-48710841
AGexonicDe novounknown16.46-Lim2017 E
PRKDC     SP0073612chr8:
48856446-48856446
AGintronicDe novo--Fu2022 E
PRKDC     SP0005776chr8:
48706988-48706988
GAexonicDe novounknown--Fu2022 E
PRKDC     2-1715-004chr8:
48739778-48739782
TGACATintronicDe novo--Yuen2017 G
PRKDC     SP0049129chr8:
48868437-48868437
ATexonicDe novounknown--Feliciano2019 E
Fu2022 E
PRKDC     11002.p1chr8:
48807196-48807196
GAintronicDe novo--Turner2016 G
PRKDC     7-0179-003chr8:
48837263-48837276
ACTCTCTCTCTCTCACTCTCTCTCTCintronicDe novo--Yuen2017 G
PRKDC     14496.p1chr8:
48761230-48761230
GAintronicDe novo--Turner2016 G
PRKDC     Lim2017:68655chr8:
48849076-48849076
GAexonicDe novounknown20.24.15E-5Lim2017 E
PRKDC     SSC04245chr8:
48827944-48827944
CAexonicDe novounknown17.63-Lim2017 E
PRKDC     19283-30834chr8:
48812932-48812932
CAsplicingInheritedsplicing14.06-Callaghan2019 G
PRKDC     SSC09735chr8:
48852146-48852146
AGexonicDe novounknown21.0-Fu2022 E
Lim2017 E
PRKDC     AU076509chr8:
48691029-48691029
GAexonicDe novounknown1.0893.059E-5Yuen2017 G
PRKDC     5-0138-003chr8:
48868650-48868650
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More