or
or
Exact

Results for "NOL4"

Variant Events: 29

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
NOL4     1-0652-004chr18:
31694620-31694620
TCintronicDe novo--Yuen2017 G
NOL4     2-1322-004chr18:
31533550-31533550
TCintronicDe novo--Yuen2017 G
NOL4     2-1511-003chr18:
31961621-31961636
CAGAGAGAGAGAGAGACAGAGAGAGAGAGAintergenicDe novo--Yuen2017 G
NOL4     1-0274-004chr18:
31693392-31693392
CGintronicDe novo--Yuen2017 G
NOL4     AU3586303chr18:
31459294-31459294
TAintronicDe novo--Yuen2017 G
NOL4     AU3912302chr18:
31514515-31514515
GAintronicDe novo--Yuen2017 G
NOL4     13143.p1chr18:
31703913-31703913
TAintronicDe novo--Wilfert2021 G
NOL4     A20chr18:
31785561-31785561
CAintronicDe novo--Wu2018 G
NOL4     AU4310301chr18:
31680663-31680663
GTintronicDe novo--Yuen2017 G
NOL4     AU3905301chr18:
31723775-31723775
GAintronicDe novo--Yuen2017 G
NOL4     2-1391-003chr18:
31686155-31686155
ATintronicDe novo--Yuen2017 G
NOL4     AU4211304chr18:
31768280-31768280
TCintronicDe novo--Yuen2017 G
NOL4     2-1169-003chr18:
31657098-31657098
GAintronicDe novo--Yuen2017 G
NOL4     1-0965-003chr18:
32030587-32030587
GAintergenicDe novo--Yuen2017 G
NOL4     14015.p1chr18:
31983713-31983713
GAintergenicDe novo--Turner2016 G
NOL4     1-0041-003chr18:
31946736-31946736
GTintergenicDe novo--Yuen2016 G
Yuen2017 G
NOL4     AU076704chr18:
31488851-31488851
TAintronicDe novo--Yuen2017 G
NOL4     14246.p1chr18:
31803227-31803227
GCUTR5De novo--Iossifov2014 E
Kosmicki2017 E
Satterstrom2020 E
NOL4     74-0688chr18:
31567744-31567744
AGintronicDe novo--Michaelson2012 G
NOL4     63-343chr18:
31791702-31791702
AGintronicDe novo--Michaelson2012 G
NOL4     1-0338-005chr18:
31993209-31993209
TCintergenicDe novo--Yuen2017 G
NOL4     1-0736-003chr18:
31655155-31655155
TCintronicDe novo--Yuen2017 G
NOL4     1-0274-003chr18:
31693392-31693392
CGintronicDe novo--Yuen2017 G
NOL4     AU3371302chr18:
32046281-32046281
TCintergenicDe novo--Yuen2017 G
NOL4     2-1437-003chr18:
31765859-31765859
CTintronicDe novo--Yuen2017 G
NOL4     5-0061-003chr18:
31569460-31569460
AGintronicDe novo--Yuen2017 G
NOL4     AU045514chr18:
31482028-31482028
GAintronicDe novo--Yuen2017 G
NOL4     2-1206-003chr18:
31450856-31450856
CTintronicDe novo--Yuen2016 G
Yuen2017 G
NOL4     2-0320-003chr18:
31701644-31701644
TCintronicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More