or
or
Exact

Results for "ALG10"

Variant Events: 56

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
ALG10     1-0219-003chr12:
34736809-34736809
TAintergenicDe novo--Yuen2017 G
ALG10     AU4485302chr12:
34850804-34850804
TCintergenicDe novo--Yuen2017 G
ALG10     2-1738-003chr12:
34490792-34490792
CTintergenicDe novo--Yuen2017 G
ALG10     AU3900301chr12:
34791555-34791555
AGintergenicDe novo--Yuen2017 G
ALG10     AU3721302chr12:
34346056-34346056
TGintergenicDe novo--Yuen2017 G
ALG10     2-1693-003chr12:
34447200-34447200
CTintergenicDe novo--Yuen2017 G
ALG10     2-0063-005chr12:
34740532-34740532
TCintergenicDe novo--Yuen2017 G
ALG10     7-0127-003chr12:
34683551-34683551
GAintergenicDe novo--Yuen2017 G
ALG10     1-0353-003chr12:
34735581-34735581
TCintergenicDe novo--Yuen2017 G
ALG10     1-0395-004chr12:
34774479-34774479
GAintergenicDe novo--Yuen2017 G
ALG10     5-0074-003chr12:
34613540-34613540
TCintergenicDe novo--Yuen2017 G
ALG10     2-0144-004chr12:
34674015-34674015
ATintergenicDe novo--Yuen2017 G
ALG10     AU4093302chr12:
34363083-34363083
CTintergenicDe novo--Yuen2017 G
ALG10     1-0998-003chr12:
34396598-34396598
CTintergenicDe novo--Yuen2017 G
ALG10     2-1508-003chr12:
34735600-34735600
GAintergenicDe novo--Yuen2017 G
ALG10     AU063005chr12:
34345513-34345513
AGintergenicDe novo--Yuen2017 G
ALG10     1-0138-004chr12:
34735237-34735237
TCintergenicDe novo--Yuen2017 G
ALG10     1-0252-003chr12:
34694141-34694141
GGTCintergenicDe novo--Yuen2017 G
ALG10     1-0252-003chr12:
34422459-34422459
CCAintergenicDe novo--Yuen2017 G
ALG10     1-0358-003chr12:
34736789-34736789
GAintergenicDe novo--Yuen2017 G
ALG10     2-1258-004chr12:
34485262-34485262
CTintergenicDe novo--Yuen2017 G
ALG10     1-0079-003chr12:
34674003-34674003
TAintergenicDe novo--Yuen2017 G
ALG10     AU2427302chr12:
34763487-34763487
GAintergenicDe novo--Yuen2017 G
ALG10     7-0223-003chr12:
34730237-34730238
TATintergenicDe novo--Yuen2017 G
ALG10     74-0117chr12:
34787157-34787157
GAintergenicDe novo--Michaelson2012 G
ALG10     AU3721301chr12:
34202666-34202666
GAintergenicDe novo--Yuen2017 G
ALG10     1-0395-003chr12:
34774479-34774479
GAintergenicDe novo--Yuen2017 G
ALG10     AU3702306chr12:
34539350-34539350
GTintergenicDe novo--Yuen2017 G
ALG10     1-0323-004chr12:
34736806-34736806
GCintergenicDe novo--Yuen2017 G
ALG10     2-1626-003chr12:
34725092-34725092
GCintergenicDe novo--Yuen2017 G
ALG10     1-0567-003chr12:
34739360-34739360
TTCCAAAATGCTGTATCCAAACAAAGGTTCintergenicDe novo--Yuen2017 G
ALG10     AU4032307chr12:
34598915-34598915
CTintergenicDe novo--Yuen2017 G
ALG10     3-0458-000Achr12:
34395420-34395434
CTGTGTGTGTGTGTGCTGTGTGTGTGTGintergenicDe novo--Yuen2017 G
ALG10     1-0495-003chr12:
34748100-34748100
ATintergenicDe novo--Yuen2017 G
ALG10     AU002903chr12:
34714598-34714598
CTintergenicDe novo--Yuen2017 G
ALG10     AU011704chr12:
34787157-34787157
GAintergenicDe novo--Yuen2017 G
ALG10     AU011704chr12:
34442581-34442581
TCintergenicDe novo--Yuen2017 G
ALG10     AU3808304chr12:
34344262-34344262
GAintergenicDe novo--Yuen2017 G
ALG10     1-0347-003chr12:
34436501-34436501
AGintergenicDe novo--Yuen2017 G
ALG10     AU072904chr12:
34663546-34663546
GAintergenicDe novo--Yuen2017 G
ALG10     AU3903301chr12:
34845195-34845195
TCintergenicDe novo--Yuen2017 G
ALG10     AU4032306chr12:
34226616-34226616
ACintergenicDe novo--Yuen2017 G
ALG10     AU3720302chr12:
34261385-34261385
GCintergenicDe novo--Yuen2017 G
ALG10     3-0391-000chr12:
34361944-34361944
GAintergenicDe novo--Yuen2017 G
ALG10     AU3057302chr12:
34435929-34435929
CTintergenicDe novo--Yuen2017 G
ALG10     AU009904chr12:
34600825-34600825
GAintergenicDe novo--Yuen2017 G
ALG10     AU076705chr12:
34580092-34580092
TCintergenicDe novo--Yuen2017 G
ALG10     1-0757-003chr12:
34512900-34512900
TCintergenicDe novo--Yuen2017 G
ALG10     AU054303chr12:
34581574-34581574
GAintergenicDe novo--Yuen2017 G
ALG10     AU4164301chr12:
34644176-34644176
GAintergenicDe novo--Yuen2017 G
ALG10     AU054303chr12:
34775909-34775909
TCintergenicDe novo--Yuen2017 G
ALG10     AU0039303chr12:
34726570-34726570
TCintergenicDe novo--Yuen2017 G
ALG10     1-0244-003chr12:
34482282-34482282
GAintergenicDe novo--Yuen2017 G
ALG10     2-1408-003chr12:
34772386-34772386
GAintergenicDe novo--Yuen2017 G
ALG10     2-1408-003chr12:
34756000-34756000
GAintergenicDe novo--Yuen2017 G
ALG10     AU3913302chr12:
34471819-34471819
CAintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More