or
or
Exact

Results for "TACR1"

Variant Events: 23

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TACR1     AU4159301chr2:
75423815-75423815
GCintronicDe novo--Yuen2017 G
TACR1     2-0003-003chr2:
75453399-75453399
CGintergenicDe novo--Yuen2017 G
TACR1     1-0896-003chr2:
75568930-75568930
AGintergenicDe novo--Yuen2017 G
TACR1     2-1549-003chr2:
75505260-75505274
AAGAAGCACAGAAGCAAGAAGCintergenicDe novo--Yuen2017 G
TACR1     AU4033303chr2:
75660449-75660449
CTintergenicDe novo--Yuen2017 G
TACR1     2-0135-003chr2:
75671160-75671160
ACintergenicDe novo--Yuen2017 G
TACR1     2-1579-003chr2:
75663499-75663499
GAintergenicDe novo--Yuen2017 G
TACR1     AU3761301chr2:
75465510-75465510
CTintergenicDe novo--Yuen2017 G
TACR1     AU011704chr2:
75459188-75459188
AGintergenicDe novo--Yuen2017 G
TACR1     AU3951302chr2:
75688145-75688145
CTintergenicDe novo--Yuen2017 G
TACR1     2-1501-003chr2:
75361171-75361171
CAintronicDe novo--Yuen2017 G
TACR1     2-1416-004chr2:
75274621-75274621
AGUTR3De novo--Yuen2017 G
TACR1     1-0570-003chr2:
75504385-75504385
GTintergenicDe novo--Yuen2017 G
TACR1     AU4032305chr2:
75391549-75391549
ACintronicDe novo--Yuen2017 G
TACR1     AU4359301chr2:
75711826-75711826
GAintergenicDe novo--Yuen2017 G
TACR1     AU026412chr2:
75288581-75288581
GAintronicDe novo--Yuen2017 G
TACR1     AU038203chr2:
75376321-75376321
CGintronicDe novo--Yuen2017 G
TACR1     2-1358-003chr2:
75550432-75550432
GCintergenicDe novo--Yuen2017 G
TACR1     74-0117chr2:
75459188-75459188
AGintergenicDe novo--Michaelson2012 G
TACR1     1-0112-003chr2:
75523071-75523071
TCintergenicDe novo--Yuen2017 G
TACR1     2-1416-003chr2:
75274621-75274621
AGUTR3De novo--Yuen2017 G
TACR1     AU060703chr2:
75640753-75640753
TCintergenicDe novo--Yuen2017 G
TACR1     1-0402-003chr2:
75595064-75595064
GTintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More