or
or
Exact

Results for "TMEM135"

Variant Events: 53

Gene
Gene symbol on which the variant is located
ID
Subject Identifier from the original study
Location
Genomic location of the reference allele
REF
Reference allele
ALT
Alternate allele
Context
Variant functional categories
Variant validation performed by an orthogonal method and reported
Inheritance
Reported inheritance status
Effects
Variant effect on transcript per Annovar
Transcript
Transcript used for the cDNA/Protein mutation
cDNA
cDNA variant notation
Protein
Protein variant notation
CADD-Phred v1.0
CADD phred-like score. This is phred-like rank score based on whole genome CADD raw scores
ExAC v0.3
ExAC population frequency (version 0.3)
Sources
Source(s) where variants from this event are reported
TMEM135     13964.p1chr11:
86871104-86871104
AGintronicUnknown, De novo--Turner2016 G
Werling2018 G
TMEM135     2-1529-003chr11:
87074042-87074042
CTintergenicDe novo--Yuen2017 G
TMEM135     2-1169-003chr11:
87311929-87311929
ATintergenicDe novo--Yuen2017 G
TMEM135     1-0051-004chr11:
86865854-86865854
TTGGTGAintronicDe novo--Yuen2017 G
TMEM135     AU4423303chr11:
87040359-87040359
ACdownstreamDe novo--Yuen2017 G
TMEM135     AU4092302chr11:
87091522-87091522
TCintergenicDe novo--Yuen2017 G
TMEM135     2-1267-003chr11:
87320183-87320188
TAAATGTintergenicDe novo--Yuen2017 G
TMEM135     AU4079302chr11:
87634224-87634231
CTTTTTTTCTTTTTTTTintergenicDe novo--Yuen2017 G
TMEM135     2-0028-003chr11:
87411416-87411416
CTintergenicDe novo--Yuen2017 G
TMEM135     AU061003chr11:
86785315-86785315
TCintronicDe novo--Yuen2017 G
TMEM135     AU063005chr11:
87651681-87651681
CTintergenicDe novo--Yuen2017 G
TMEM135     2-0244-003chr11:
87072079-87072079
ATintergenicDe novo--Yuen2017 G
TMEM135     AU4336301chr11:
86763719-86763719
ATintronicDe novo--Yuen2017 G
TMEM135     63-449chr11:
87813204-87813204
CTintergenicDe novo--Michaelson2012 G
TMEM135     AU4079301chr11:
87113145-87113145
AGintergenicDe novo--Yuen2017 G
TMEM135     AU4197301chr11:
87243508-87243508
GTintergenicDe novo--Yuen2017 G
TMEM135     AU3891304chr11:
86875435-86875435
TCintronicDe novo--Yuen2017 G
TMEM135     2-0323-004chr11:
86825129-86825129
CCAintronicDe novo--Yuen2017 G
TMEM135     1-0079-003chr11:
87433692-87433692
TGintergenicDe novo--Yuen2017 G
TMEM135     AU2458303chr11:
86790668-86790668
AGintronicDe novo--Yuen2017 G
TMEM135     AU3702306chr11:
87747268-87747268
CGintergenicDe novo--Yuen2017 G
TMEM135     2-1620-004chr11:
87354263-87354263
GAintergenicDe novo--Yuen2017 G
TMEM135     A20chr11:
87062181-87062181
CTintergenicDe novo--Wu2018 G
TMEM135     1-0181-004chr11:
87750277-87750277
GTintergenicDe novo--Yuen2017 G
TMEM135     2-1626-003chr11:
87558888-87558888
GCintergenicDe novo--Yuen2017 G
TMEM135     AU076508chr11:
87632879-87632879
CTintergenicDe novo--Yuen2017 G
TMEM135     1-0566-003chr11:
87138338-87138354
AATATATATATATATATAATATATATATATATintergenicDe novo--Yuen2017 G
TMEM135     AU4344301chr11:
87456625-87456625
CGintergenicDe novo--Yuen2017 G
TMEM135     AU3637301chr11:
87758610-87758610
TCintergenicDe novo--Yuen2017 G
TMEM135     2-0016-003chr11:
87495592-87495592
GAintergenicDe novo--Yuen2017 G
TMEM135     AU026604chr11:
87469565-87469565
GAintergenicDe novo--Yuen2017 G
TMEM135     AU2075301chr11:
87067550-87067550
CGintergenicDe novo--Yuen2017 G
TMEM135     AU2123302chr11:
87651494-87651503
CTATATATATCTATATATATATintergenicDe novo--Yuen2017 G
TMEM135     AU2075301chr11:
87071537-87071537
CTintergenicDe novo--Yuen2017 G
TMEM135     AU2023302chr11:
87073258-87073264
GTGTTGTGTGTintergenicDe novo--Yuen2017 G
TMEM135     7-0149-003chr11:
86815038-86815038
ACintronicDe novo--Yuen2017 G
TMEM135     AU2248301chr11:
86888841-86888841
GCintronicDe novo--Yuen2017 G
TMEM135     1-0534-006chr11:
87018051-87018051
GAintronicDe novo--Yuen2017 G
TMEM135     1-0534-006chr11:
86988527-86988527
AGintronicDe novo--Yuen2017 G
TMEM135     2-1379-003chr11:
86892534-86892534
CGintronicDe novo--Yuen2016 G
Yuen2017 G
TMEM135     2-1132-003chr11:
86758635-86758635
TTGintronicDe novo--Yuen2017 G
TMEM135     1-0054-004chr11:
86986950-86986950
CTintronicDe novo--Yuen2017 G
TMEM135     2-0036-003chr11:
87495592-87495592
GAintergenicDe novo--Yuen2016 G
TMEM135     AU4093301chr11:
86757120-86757131
AAAAGTAAAGTAAAAAGTAintronicDe novo--Yuen2017 G
TMEM135     2-1336-004chr11:
87198673-87198673
ATintergenicDe novo--Yuen2017 G
TMEM135     2-1436-003chr11:
87326837-87326837
GAintergenicDe novo--Yuen2017 G
TMEM135     AU058105chr11:
86943283-86943283
GAintronicDe novo--Yuen2017 G
TMEM135     2-1629-003chr11:
87593152-87593152
GTintergenicDe novo--Yuen2017 G
TMEM135     AU4060306chr11:
87337996-87337996
GAintergenicDe novo--Yuen2017 G
TMEM135     AU3692301chr11:
86758539-86758539
CTintronicDe novo--Yuen2017 G
TMEM135     1-0292-005chr11:
87125241-87125241
CTintergenicDe novo--Yuen2017 G
TMEM135     5-0123-003chr11:
87176352-87176353
CTCintergenicDe novo--Yuen2017 G
TMEM135     2-1365-003chr11:
87217007-87217007
GCintergenicDe novo--Yuen2017 G
Source Variant Information

, -

Source:

Paper alias:

No records found.
Paper Information
Title
Authors
Technology
Variant source
Cohorts
Design
URL
Pubmed
Subject count
The number of subjects for this study could not be determined directly from the variant data; the value given is that reported by the authors in the publication.
Variant event count
Curation notesView
More